Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32199

Smpx small muscle protein, X-linked ( MGI:1913356)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32199 EMAGE:32199 EMAGE:32199 EMAGE:32199 EMAGE:32199
euxassay_006968_01 euxassay_006968_02 euxassay_006968_03 euxassay_006968_04 euxassay_006968_05
EMAGE:32199 EMAGE:32199 EMAGE:32199 EMAGE:32199 EMAGE:32199
euxassay_006968_06 euxassay_006968_07 euxassay_006968_08 euxassay_006968_09 euxassay_006968_10
EMAGE:32199 EMAGE:32199 EMAGE:32199 EMAGE:32199 EMAGE:32199
euxassay_006968_11 euxassay_006968_12 euxassay_006968_13 euxassay_006968_14 euxassay_006968_15
EMAGE:32199 EMAGE:32199 EMAGE:32199 EMAGE:32199 EMAGE:32199
euxassay_006968_16 euxassay_006968_17 euxassay_006968_18 euxassay_006968_19 euxassay_006968_20
EMAGE:32199 EMAGE:32199 EMAGE:32199
euxassay_006968_21 euxassay_006968_22 euxassay_006968_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
heart ventricle
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
tail paraxial mesenchyme
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16
tongue muscle
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
foot
strong strong
regionalstrong expression: see section 02 03 04 19 20 21
eye skeletal muscle
strong strong
regionalstrong expression: see section 02 03 04 05 06 19 20 21 22
heart atrium
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 17 18 19 20 21 22 23
leg muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 16 17 18 19 20 21 22 23
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
arm muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 23
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 20 21 22 23
hand
strong strong
regionalstrong expression: see section 01 02
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T9974
Entity Detected:Smpx, small muscle protein, X-linked ( MGI:1913356)
Sequence:sense strand is shown

>T9974
AGAGGACACCGGGAGTTCCTTCTATCCTGTAAAGCGCTTTTTGTGTTTTTGCACCTGGCCGCCTGGGACT
GTCCTCAGGCAGTAAACCAATCCAGAGAGCAGGGCTAAGACCTTGTGAATATGTCGAAGCAGCCAATTTC
CAACGTCAGAGCCATCCAGGCGAATATCAATATTCCAATGGGAGCCTTTCGTCCGGGAGCTGGGCAGCCT
CCCAGAAGGAAAGAGAGTACTCCTGAAACTGAGGAGGGAGCTCCTACCACCTCAGAGGAAAAGAAGCCAA
TTCCTGGAATGAAGAAATTTCCAGGACCTGTTGTCAACTTGTCTGAGATCCAAAATGTTAAAAGTGAACT
GAAATTTGTCCCCAAAGGTGAACAGTAGTCGAAAGGACACAAAAGTTCACATTGGATGCTTAGAATCAGG
AGATGCATTTCGTTGACGTGTTTTTCCAAGGGAGAAAAAACAATGGGTTGAAATAAACAACTTCCTGAAC
ATTTTATACATTTGTATGATGATCACAAACCTCCTGAATGCCCAAGACTCTAGCAAAAATATCCTGTTTG
TACATTTATATTTCTTCCTTTTACTTGGTTGCATTTCTCACTTTAGCTACATTTTTGGCACCTTGTAGAG
CAAATCAGCACACGAATTTACAACCTGGGAAGTGTGGTTTTGAGGAGAGATGTGATTTTTATGAAGGGGG
GGATGGCAACGTGCAAGCAGTGATTTTGATGTTAAGTACTTTAAGTTACTTCCCACGGTCTTTTGGTCAA
TATTTGAAATGGTTTCTTCACCTTTTAAATTATCTCAATTAACTTTTTATGAGTTCAAATAAATATTTGA
GTAAATCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:30300606 using vector (pDNR-LIB) specific primers. Forward Primer - name:M13 forward (-21), sequence:TGTAAAACGACGGCCAGT; Reverse Primer - name:T3-pDNR-LIB rv, sequence:CAAATTAACCCTCACTAAAGGGTGTTCACTTACCTACTGGGC. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:30300606 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_006968 same experiment
 EMAGE:29576 same embryo
 EMAGE:32211 same embryo
 EMAGE:32244 same embryo
 EMAGE:29933 same embryo
 EMAGE:29932 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS