Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32238

Zdhhc8 zinc finger, DHHC domain containing 8 ( MGI:1338012)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32238 EMAGE:32238 EMAGE:32238 EMAGE:32238 EMAGE:32238
euxassay_016524_01 euxassay_016524_02 euxassay_016524_03 euxassay_016524_04 euxassay_016524_05
EMAGE:32238 EMAGE:32238 EMAGE:32238 EMAGE:32238 EMAGE:32238
euxassay_016524_06 euxassay_016524_07 euxassay_016524_08 euxassay_016524_09 euxassay_016524_10
EMAGE:32238 EMAGE:32238 EMAGE:32238 EMAGE:32238 EMAGE:32238
euxassay_016524_11 euxassay_016524_12 euxassay_016524_13 euxassay_016524_14 euxassay_016524_15
EMAGE:32238 EMAGE:32238 EMAGE:32238 EMAGE:32238 EMAGE:32238
euxassay_016524_16 euxassay_016524_17 euxassay_016524_18 euxassay_016524_19 euxassay_016524_20
EMAGE:32238 EMAGE:32238 EMAGE:32238 EMAGE:32238
euxassay_016524_21 euxassay_016524_22 euxassay_016524_23 euxassay_016524_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
weak weak
regionalweak expression: see section 03 04 05 10 11 12
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 16 17 18 19
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 12 13 14 16 weak expression: see section 10 11 15
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 10 11 12 13 14 15 16
telencephalon mantle layer
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 04 21
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38742
Entity Detected:Zdhhc8, zinc finger, DHHC domain containing 8 ( MGI:1338012)
Sequence:sense strand is shown

>T38742
TAGAGGCTGGTACCTTTGGAAGAGATCTGAAGACCCCAAGACCTGGCAGTGCTGAGAGTGCCCTATCAGT
ACAGAGGACCAGCCCCCCAACACCTGCCATGTATAAGTTCCGGCCAGCCTTCTCCACTGGTCCCAAGACA
CCCTTTTGTGGACCTAATGAGCAGGTCCCAGGTCCTGACTCCCTTACTCTGGCAGATGACAGCACCCACA
GTCTAGACTTTGTGTCTGAGCCCAGCCTGGATCTCCCAGACCACGGGCCGGGTGGTCTGCGTCCTCCCTA
CCCGCCCTCCCCACCCCTCAACACCACTGATGCCTTCTCAGGTGCCTTGCGCTCCCTGAGTCTCAAGGCT
GCCAGTCGGAGGGGTGGGGACCACATGACCTTACAGCCACTGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 163912. Forward Primer - name:163912_F_cDNA_mCG131845.1, sequence:TAGAGGCTGGTACCTTTGGAAG; Reverse Primer - name:163912_N_SP6_cDNA_mCG131845.1, sequence:GCAGTGGCTGTAAGGTCATG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_016524 same experiment
 EMAGE:32231 same embryo
 EMAGE:32228 same embryo
 EMAGE:32229 same embryo
 EMAGE:31920 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS