Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32245

Mnx1 motor neuron and pancreas homeobox 1 ( MGI:109160)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32245 EMAGE:32245 EMAGE:32245 EMAGE:32245 EMAGE:32245
euxassay_016637_01 euxassay_016637_02 euxassay_016637_03 euxassay_016637_04 euxassay_016637_05
EMAGE:32245 EMAGE:32245 EMAGE:32245 EMAGE:32245 EMAGE:32245
euxassay_016637_06 euxassay_016637_07 euxassay_016637_08 euxassay_016637_09 euxassay_016637_10
EMAGE:32245 EMAGE:32245 EMAGE:32245 EMAGE:32245 EMAGE:32245
euxassay_016637_11 euxassay_016637_12 euxassay_016637_13 euxassay_016637_14 euxassay_016637_15
EMAGE:32245 EMAGE:32245 EMAGE:32245 EMAGE:32245 EMAGE:32245
euxassay_016637_16 euxassay_016637_17 euxassay_016637_18 euxassay_016637_19 euxassay_016637_20
EMAGE:32245 EMAGE:32245 EMAGE:32245
euxassay_016637_21 euxassay_016637_22 euxassay_016637_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45090
Entity Detected:Mnx1, motor neuron and pancreas homeobox 1 ( MGI:109160)
Sequence:sense strand is shown

>T45090
GACGAGGATGATGAAGAAGAGGACAACTTCCCGTACAGCAATGGTGCCGGTGCCCATGCTGCCTCATCCG
ACTGCTCATCTGAGGACGACTCGCCTCCTCCAAGACTAGGCGGGCCTGGACACCAACCTCTGCCCCAGTA
GTTGCCTCCAGGGCGGAAGCAGGGATGCGAAAGATGGCTACCTGGGGGGCTGCGGGGCTTGGGGGAGTTT
ACAATCCCATCCTATGGCCTGCAGCCAGGCTGACAGCCTCTCCCCGAACCATGCATCCAAGTGCAGGCTG
GGCTGCGGATCCTTTTTGGGACCTCGAGGGGACAGCAAGAGAGAATGAGAGAGGAGCTCCAATGTGAGCT
TTTCGTTCTTATACATTTAATTTCGGGTGATGTTGGCCAGAGGTATCTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 168178168178. Forward Primer - name:168178_F_Hlxb9, sequence:GACGAGGATGATGAAGAAGAGG; Reverse Primer - name:168178_R_SP6_Hlxb9, sequence:CCAGATACCTCTGGCCAACAT.The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_016637 same experiment
 EMAGE:29374 same embryo
 EMAGE:29377 same embryo
 EMAGE:29554 same embryo
 EMAGE:29557 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS