Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6645

Dok2 docking protein 2 ( MGI:1332623)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6645 EMAGE:6645 EMAGE:6645 EMAGE:6645 EMAGE:6645
"Pseudo-wholemount" of euxassay_002227. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002227_01 euxassay_002227_02 euxassay_002227_03 euxassay_002227_04
EMAGE:6645 EMAGE:6645 EMAGE:6645 EMAGE:6645 EMAGE:6645
euxassay_002227_05 euxassay_002227_06 euxassay_002227_07 euxassay_002227_08 euxassay_002227_09
EMAGE:6645 EMAGE:6645 EMAGE:6645 EMAGE:6645 EMAGE:6645
euxassay_002227_10 euxassay_002227_11 euxassay_002227_12 euxassay_002227_13 euxassay_002227_14
EMAGE:6645 EMAGE:6645 EMAGE:6645 EMAGE:6645 EMAGE:6645
euxassay_002227_15 euxassay_002227_16 euxassay_002227_17 euxassay_002227_18 euxassay_002227_19
EMAGE:6645 EMAGE:6645 EMAGE:6645 EMAGE:6645
euxassay_002227_20 euxassay_002227_21 euxassay_002227_22 euxassay_002227_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6645Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6645_wholemount_strong.wlz
6645_wholemount_moderate.wlz
6645_wholemount_weak.wlz
6645_wholemount_possible.wlz
6645_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6645_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2003
Entity Detected:Dok2, docking protein 2 ( MGI:1332623)
Sequence:sense strand is shown

>T2003
TGGCCTCGAGCCAGATTCGGCACGAGGGGGNATGGCCAGAAGATGGGATATGTGGTTCCCAGGGAGGTCT
TCGGAAGCTGTGGAGGGGAAATGGTGGCTTCTGGTAGAGTCCTTTTGGTTACTGCCCCTTCCTGGGCCCC
AGGCTCGGTGTGCCTTATTTGTGTACTGTGTGAGTCACTAGCCTGGAGCAGAAAGAGGGCCCTGGAGGGA
CCCACCCTCCTCCTACACTTTTCCACTTCCTCCCACTGCCTTGGGTCTAAAGGGAACTGGGGCCATTTCT
CTTAAGAGACAAAGGGTTTCCACAGATGTCCTGGCTCCTCGGTGTGGGCAGGCCTCCTGCCTATAGATGT
TTTGTTCCTGGGACAACCCTGGCTTCTGGTTAGCAGCGAGAGTAGCTGTTGTCCCTCTAGCTCCCAGAGT
TTTCTATACATTAAACCAATTTCGAACTAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:722550 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:722550 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:BL6/SV129
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6642 same embryo
 EMAGE:6641 same embryo
 EMAGE:6643 same embryo
 EMAGE:6644 same embryo
 EurExpress:euxassay_002227 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS