Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6668

Gjb3 gap junction protein, beta 3 ( MGI:95721)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6668 EMAGE:6668 EMAGE:6668 EMAGE:6668 EMAGE:6668
"Pseudo-wholemount" of euxassay_007359. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007359_01 euxassay_007359_02 euxassay_007359_03 euxassay_007359_04
EMAGE:6668 EMAGE:6668 EMAGE:6668 EMAGE:6668 EMAGE:6668
euxassay_007359_05 euxassay_007359_06 euxassay_007359_07 euxassay_007359_08 euxassay_007359_09
EMAGE:6668 EMAGE:6668 EMAGE:6668 EMAGE:6668 EMAGE:6668
euxassay_007359_10 euxassay_007359_11 euxassay_007359_12 euxassay_007359_13 euxassay_007359_14
EMAGE:6668 EMAGE:6668 EMAGE:6668 EMAGE:6668 EMAGE:6668
euxassay_007359_15 euxassay_007359_16 euxassay_007359_17 euxassay_007359_18 euxassay_007359_19
EMAGE:6668 EMAGE:6668 EMAGE:6668 EMAGE:6668 EMAGE:6668
euxassay_007359_20 euxassay_007359_21 euxassay_007359_22 euxassay_007359_23 euxassay_007359_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6668Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6668_wholemount_strong.wlz
6668_wholemount_moderate.wlz
6668_wholemount_weak.wlz
6668_wholemount_possible.wlz
6668_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6668_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vibrissa
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 19 20 21 22 23 24
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 22 23 24
naris
weak weak
regionalweak expression: see section 12 14
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 11 15 17 18 19 weak expression: see section 08 09 10 16
stomach
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 19
oral epithelium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 15 16 17 18 19 20 21 weak expression: see section 11 12 13 14
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 15
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3042
Entity Detected:Gjb3, gap junction protein, beta 3 ( MGI:95721)
Sequence:sense strand is shown

>T3042
TGGCCTCGAGCCAGATTCGTCGACTCATCGAATTGGTCTTCCTGTACGTTCTCCACACGCTCTGGCATGG
CTTCACCATGCCGCGTCTGGTACAGTGCGCCAGCATAGTACCCTGCCCCAACACCGTGGATTGCTACATC
GCTCGGCCCACTGAGAAGAAGGTCTTTACCTACTTCATGGTAGGCGCTTCTGCCGTCTGCATTATTCTCA
CCATCTGTGAGATCTGCTACCTCATCTTCCACAGGATCATGCGAGGCATAAGCAAGGGCAAGTCCACAAA
GAGCATCAGCTCCCCGAAGTCCTCCAGCCGGGCCTCCACCTGTCGCTGTCACCACAAGCTGCTGGAGAGT
GGCGATCCGGAAGCAGACCCAGCCAGTGAAAAGCTGCAGGCTTCAGCGCCCAGCCTGACCCCCATTTGAA
CCAGGTGCTAGAGAAAGGGTGAAGCCGGGAGGTGCTGCAGGTGAAGGGGTCCTGGGGGCGCCGAGTGCCC
CCACTTTGAATTCACTAAGCTAGCCAATTGTGTTTGAAGCAGGTATTTGTGGGTGC
Notes:The probe template was PCR amplified from IMAGE:1546069 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1546069 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6666 same embryo
 EMAGE:6665 same embryo
 EMAGE:6667 same embryo
 EurExpress:euxassay_007359 same experiment
 MGI:4825061 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS