EMAGE mouse gene expression spatial database

EMAGE:6697

Ddx24 DEAD (Asp-Glu-Ala-Asp) box polypeptide 24 ( MGI:1351337)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_007314. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_007314_01	euxassay_007314_02	euxassay_007314_03	euxassay_007314_04

euxassay_007314_05	euxassay_007314_06	euxassay_007314_07	euxassay_007314_08	euxassay_007314_09

euxassay_007314_10	euxassay_007314_11	euxassay_007314_12	euxassay_007314_13	euxassay_007314_14

euxassay_007314_15	euxassay_007314_16	euxassay_007314_17	euxassay_007314_18	euxassay_007314_19

euxassay_007314_20	euxassay_007314_21	euxassay_007314_22

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T1880
Entity Detected:	Ddx24, DEAD (Asp-Glu-Ala-Asp) box polypeptide 24 ( MGI:1351337)
Sequence:	sense strand is shown >T1880 TGGCCTCGAGNCAGATTCGGACGAGGAGTCTGGCAGGCCGCCTCAGCCTGTGCTGGCCTCCAGGAATATC GAGTCTGCGCTGAGCTGCCTGTCTAGGCAGAAGAGGAGGAGGAAGAAGCCAAAAGAACCCCGGGCACCAC CACAGCCAGGTTCAAGCACGAGTTAACTGCCCGGTCAATGTGGTGACTGTTGTCTGTAAAGGCTTCCCTC CTTGCCTTTCACTCCACCATCCACCTGCGCAAACCTCCCGCTCTTCCATCCTTTAGCAGGAAAGACCTCC CGCACACATGTTGTGGAGTTAAATGTGGCAGGTGACGCTGTGTGTCTGTAGTCAGTGTATGCAGACTTCT TGTGCTCACCTTGTTTTCCAGATTAAACCAAGTAGGAGTCAGAGAAAAAAAAAAAAAAA
Notes:	The probe template was PCR amplified from IMAGE:597155 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:597155 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:6696 same embryo
	EMAGE:6693 same embryo
	EMAGE:6695 same embryo
	EMAGE:6698 same embryo
	EMAGE:6694 same embryo
	EurExpress:euxassay_007314 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source