Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6745

Ruvbl2 RuvB-like protein 2 ( MGI:1342299)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6745 EMAGE:6745 EMAGE:6745 EMAGE:6745 EMAGE:6745
"Pseudo-wholemount" of euxassay_002276. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002276_01 euxassay_002276_02 euxassay_002276_03 euxassay_002276_04
EMAGE:6745 EMAGE:6745 EMAGE:6745 EMAGE:6745 EMAGE:6745
euxassay_002276_05 euxassay_002276_06 euxassay_002276_07 euxassay_002276_08 euxassay_002276_09
EMAGE:6745 EMAGE:6745 EMAGE:6745 EMAGE:6745 EMAGE:6745
euxassay_002276_10 euxassay_002276_11 euxassay_002276_12 euxassay_002276_13 euxassay_002276_14
EMAGE:6745 EMAGE:6745 EMAGE:6745 EMAGE:6745 EMAGE:6745
euxassay_002276_15 euxassay_002276_16 euxassay_002276_17 euxassay_002276_18 euxassay_002276_19
EMAGE:6745 EMAGE:6745 EMAGE:6745 EMAGE:6745 EMAGE:6745
euxassay_002276_20 euxassay_002276_21 euxassay_002276_22 euxassay_002276_23 euxassay_002276_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6745Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6745_wholemount_strong.wlz
6745_wholemount_moderate.wlz
6745_wholemount_weak.wlz
6745_wholemount_possible.wlz
6745_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6745_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
axial musculature
moderate moderate
regionalmoderate expression: see section 24
axial muscle
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 21 22 23
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 17 18 19 20
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 05 19 moderate expression: see section 03 04 20 21 24
viscerocranium
strong strong
regionalExpression in the turbinate bone.
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3380
Entity Detected:Ruvbl2, RuvB-like protein 2 ( MGI:1342299)
Sequence:sense strand is shown

>T3380
TGGCCTCGAGCCAGATTCGGAACGAGGGCAGCCACCACCAAAGTCCCTGAGATCCGAGATGTGACAAGAA
TCGAGCGAATCGGCGCTCACTCCCACATCCGGGGGCTGGGACTGGATGATGCCCTGGAGCCAAGACAGGC
TTCCCAGGGAATGGTGGGGCAGCTAGCTGCCCGGCGTGCAGCTGGCGTGGTGCTGGAGATGATCCGAGAA
GGGAAGATTGCAGGGCGGGCCGTCCTCATTGCAGGCCAGCCAGGCACTGGGAAGACAGCCATTGCCATGG
GCATGGCCCAGGCACTGGGCCCCGACACACCATTCACAGCCATCGCAGGCAGTGAGATCTTTTCTCTGGA
GATGAGCAAGACTGAGGCTCTAACGCAAGCCTTCCGCCGTTCCATTGGTGTCCGGATCAAGGAGGAGACA
GAGATCATTGAAGGGGAGGTGGTAGAGATCCAGATTGACCGGCCAGCCACAGGCACGGGATCCAAGGTGG
GCAAACTGACCCTCAAGACCACGGAGATGGAGACCATCTACGACCTGGGTACCAAG
Notes:The probe template was PCR amplified from IMAGE:2938212 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2938212 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6747 same embryo
 EMAGE:6748 same embryo
 EMAGE:6744 same embryo
 EMAGE:6746 same embryo
 EMAGE:6743 same embryo
 EurExpress:euxassay_002276 same experiment
 MGI:4827840 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS