Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6756

Olfm2 olfactomedin 2 ( MGI:3045350)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6756 EMAGE:6756 EMAGE:6756 EMAGE:6756 EMAGE:6756
"Pseudo-wholemount" of euxassay_002510. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002510_01 euxassay_002510_02 euxassay_002510_03 euxassay_002510_04
EMAGE:6756 EMAGE:6756 EMAGE:6756 EMAGE:6756 EMAGE:6756
euxassay_002510_05 euxassay_002510_06 euxassay_002510_07 euxassay_002510_08 euxassay_002510_09
EMAGE:6756 EMAGE:6756 EMAGE:6756 EMAGE:6756 EMAGE:6756
euxassay_002510_10 euxassay_002510_11 euxassay_002510_12 euxassay_002510_13 euxassay_002510_14
EMAGE:6756 EMAGE:6756 EMAGE:6756 EMAGE:6756 EMAGE:6756
euxassay_002510_15 euxassay_002510_16 euxassay_002510_17 euxassay_002510_18 euxassay_002510_19
EMAGE:6756 EMAGE:6756 EMAGE:6756 EMAGE:6756
euxassay_002510_20 euxassay_002510_21 euxassay_002510_22 euxassay_002510_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6756Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6756_wholemount_strong.wlz
6756_wholemount_moderate.wlz
6756_wholemount_weak.wlz
6756_wholemount_possible.wlz
6756_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6756_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 08 20
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 09 17 18 19 20 21 22 23
vagus x ganglion
weak weak
regionalweak expression: see section 09
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 07 09 18 19 20
spinal cord
moderate moderate
homogeneousmoderate expression: see section 09 10 11 12 13 14 15 16 17
not examined not examined
regionalnot examined expression: see section 01 02 03 04 23
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 04 23
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 02 03 04 05 22 23 weak expression: see section 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2045
Entity Detected:Olfm2, olfactomedin 2 ( MGI:3045350)
Sequence:sense strand is shown

>T2045
TGGCCTCGAGGCCAGAATTCGGATCATGAGTACACGGATGTGCCCTTCCACAACCAGTATTCGCACATCT
CGATGCTGGATTACAACCCCAGGGAGCGGGCCCTGTATACCTGGAACAACGGGCACCAGGTGCTGTACAA
CGTCACCCTGTTCCACGTCATCAGCACTGCCGGGGACCCCTAGGTGCCCCTGCAAGGGCTTTGGGGAGCC
TTCCCACATCGCCTGTGACCCCCACCCCAGCCTTCTCTTGGTCATGCCCTTGCCTTCCTAGATTCCGTCT
CCCCACTTCCCCAGCCCAGCTTTCTGTTCTCAGTATCTCTACCCATGCATTTCCCCCATTTTATTGATCT
CTGCTTTTGATACTCCACTTCTGAGTCTTTCTGCCTTTTTATGGATGCTTCTCTTCCTTATTGATCGAAC
CTCTCTTCTCCTCTCCCTCCATCTACTCTCCCTCCTCTTCCTTTCCCACTTTCCCACATTCCTTACCCCT
CACTCCCACCCTATCCCTGGATCTGAGTGCATGGATTTTGTTTTTTAAATTTAT
Notes:The probe template was PCR amplified from IMAGE:776370 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:776370 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6753 same embryo
 EMAGE:6752 same embryo
 EMAGE:6755 same embryo
 EMAGE:6754 same embryo
 EMAGE:6757 same embryo
 EurExpress:euxassay_002510 same experiment
 MGI:4826855 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS