Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6763

Pacs1 phosphofurin acidic cluster sorting protein 1 ( MGI:1277113)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6763 EMAGE:6763 EMAGE:6763 EMAGE:6763 EMAGE:6763
"Pseudo-wholemount" of euxassay_007319. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007319_01 euxassay_007319_02 euxassay_007319_03 euxassay_007319_04
EMAGE:6763 EMAGE:6763 EMAGE:6763 EMAGE:6763 EMAGE:6763
euxassay_007319_05 euxassay_007319_06 euxassay_007319_07 euxassay_007319_08 euxassay_007319_09
EMAGE:6763 EMAGE:6763 EMAGE:6763 EMAGE:6763 EMAGE:6763
euxassay_007319_10 euxassay_007319_11 euxassay_007319_12 euxassay_007319_13 euxassay_007319_14
EMAGE:6763 EMAGE:6763 EMAGE:6763 EMAGE:6763 EMAGE:6763
euxassay_007319_15 euxassay_007319_16 euxassay_007319_17 euxassay_007319_18 euxassay_007319_19
EMAGE:6763 EMAGE:6763 EMAGE:6763 EMAGE:6763 EMAGE:6763
euxassay_007319_20 euxassay_007319_21 euxassay_007319_22 euxassay_007319_23 euxassay_007319_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6763Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6763_wholemount_strong.wlz
6763_wholemount_moderate.wlz
6763_wholemount_weak.wlz
6763_wholemount_possible.wlz
6763_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6763_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 weak expression: see section 21 22 23 24
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 19 20
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 18 19 20 weak expression: see section 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09 20
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 18 19 20 weak expression: see section 21
spinal cord
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 13 14 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1872
Entity Detected:Pacs1, phosphofurin acidic cluster sorting protein 1 ( MGI:1277113)
Sequence:sense strand is shown

>T1872
TGGCCTCGAGGCCAGATTCGGACGAGGCTGCCTCCAGCCTCCACCTAAGATTGTTCTGTGGCTTCATGAG
GTAGGAGACAGCAAACCCACCCCTCCACATACATTATCTGTGACTCTTACCCAGTCATATGTCTCCCTTT
TCCTGTGTCAGCTTGCGTCCCCATCCCTGCTTTGTCTTCCCACTTCTGTCATGGCAGGGCAGCAGAAAGA
GGCCCATCTCCACCAGGTCTCCCTCCAGCAGCCTCCTTCCCTCTCTCAGCCATGGATGGGTCCCAGACCT
ATCTCAGCCTCCTCATCAGTGTCTTCATGAGAGGCTGAGGACACGTGACAGAGCTAGCCCAGCCTCCATG
CCCTCTGGCACTTCAGAGCTTCTCTGTTGCCCTCTCACTGCTTCCTAGCAGTGTGGCACAGAACTGCACT
CAGAACATAGTTTTGGCATTCTTCACATCCAAGACTCCAGCCCTTCCTGCTGCCCAGCCCTACTGTCCAG
AGTGTCTCTTGGGCCTGAGAATAAGTGGGGTGGGAAGACTGGGGCCATGTT
Notes:The probe template was PCR amplified from IMAGE:596587 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:596587 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6764 same embryo
 EMAGE:6765 same embryo
 EMAGE:6767 same embryo
 EMAGE:6766 same embryo
 EurExpress:euxassay_007319 same experiment
 MGI:4827021 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS