Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7022

Aldoart2 aldolase 1 A retrogene 2 ( MGI:1931052)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7022 EMAGE:7022 EMAGE:7022 EMAGE:7022 EMAGE:7022
"Pseudo-wholemount" of euxassay_002423. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002423_01 euxassay_002423_02 euxassay_002423_03 euxassay_002423_04
EMAGE:7022 EMAGE:7022 EMAGE:7022 EMAGE:7022 EMAGE:7022
euxassay_002423_05 euxassay_002423_06 euxassay_002423_07 euxassay_002423_08 euxassay_002423_09
EMAGE:7022 EMAGE:7022 EMAGE:7022 EMAGE:7022 EMAGE:7022
euxassay_002423_10 euxassay_002423_11 euxassay_002423_12 euxassay_002423_13 euxassay_002423_14
EMAGE:7022 EMAGE:7022 EMAGE:7022 EMAGE:7022 EMAGE:7022
euxassay_002423_15 euxassay_002423_16 euxassay_002423_17 euxassay_002423_18 euxassay_002423_19
EMAGE:7022 EMAGE:7022 EMAGE:7022 EMAGE:7022 EMAGE:7022
euxassay_002423_20 euxassay_002423_21 euxassay_002423_22 euxassay_002423_23 euxassay_002423_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7022Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7022_wholemount_strong.wlz
7022_wholemount_moderate.wlz
7022_wholemount_weak.wlz
7022_wholemount_possible.wlz
7022_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7022_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
pectoral girdle and thoracic body wall musculature
moderate moderate
regionalmoderate expression: see section 11 12
foregut-midgut junction
strong strong
regionalstrong expression: see section 12 13 14
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 11 12 13
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12 13
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 weak expression: see section 14
pons ventricular layer
strong strong
regionalstrong expression: see section 08 09 11 12 13 14 15 16 17
midbrain ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17
facial vii ganglion
strong strong
regionalstrong expression: see section 02 03 moderate expression: see section 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 06 07 08 15 16 moderate expression: see section 04 05 17 18 19 20 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 06 07 moderate expression: see section 17
ventral grey horn
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 14 15
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 09 16 17
cervical ganglion
moderate moderate
regionalmoderate expression: see section 07 16
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 12 13 15
dorsal root ganglion
strong strong
regionalstrong expression: see section 08 16 17 18 moderate expression: see section 09 10 11
not examined not examined
regionalnot examined expression: see section 01 02 21 22 23
lens
moderate moderate
regionalmoderate expression: see section 23 24
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 21 22 23 weak expression: see section 24
hindgut
strong strong
regionalstrong expression: see section 12 13 14 15 16
rectum
strong strong
regionalstrong expression: see section 14
midgut
strong strong
regionalstrong expression: see section 05 06 07 08 12 13 14 15 16 moderate expression: see section 10 11
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 01 02 17 18 21 22 23
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 08 09 12 13 14
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 16
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 08 09 12 13 14
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 08 16
pectoral girdle and thoracic body wall skeleton
moderate moderate
regionalmoderate expression: see section 12
clavicle
strong strong
regionalstrong expression: see section 16 17 moderate expression: see section 08
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1906
Entity Detected:Aldoart2, aldolase 1 A retrogene 2 ( MGI:1931052)
Sequence:sense strand is shown

>T1906
TGGCCTCGAGCCAGATTCGGACGAGGCTGGCCGCTGTCTACAGGCTCTGAGCGACCACCATGTCTACCTG
GAAGGAACCTTACTGAAGCCCAACATGGTCACCGCAGGCCATGCTTGCACTCAGGTATTTTCCAGTGAAG
AGATTGCCATGGCAACTGTCACAGCACTTCGTCGCACAGTGCCCCCTGCTGTCCCTGGAGTCACTTTCCT
GTCTGGAGGACAGAGTGAAGAAGAGGCATCCATCAACCTCAATGCTATCAACAAGTGTCCCCTGCTGAAG
CCGTGGGCCTTGACTTTCTCCTATGGCCGAGCCCTGCAGGCTTCTGCCCTAAAGGCCTGGGGTGGGAAGA
AGGAGAACACGAAGGATGCCCAAGAGGAGTACATCAAGCGAGCCCAGGCCAACAGCCTTGCTTGTCAAGG
AAAGTACACCCCAAGCAATGAGTCAGGGGCAGCCGCCAGTGAATCCCTCTTCATCTCTAACCACGCCTAC
TGAGCAGAGGTGGCCTAAGGCTGCCCCTGCAGCACCCCAGGTCCCTGCC
Notes:The probe template was PCR amplified from IMAGE:599014 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:599014 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7019 same embryo
 EMAGE:7021 same embryo
 EMAGE:7018 same embryo
 EMAGE:7023 same embryo
 EMAGE:7020 same embryo
 EurExpress:euxassay_002423 same experiment
 MGI:4823087 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS