Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7547

Atp6v1f ATPase, H+ transporting, lysosomal V1 subunit F ( MGI:1913394)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7547 EMAGE:7547 EMAGE:7547 EMAGE:7547 EMAGE:7547
"Pseudo-wholemount" of euxassay_005209. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_005209_01 euxassay_005209_02 euxassay_005209_03 euxassay_005209_04
EMAGE:7547 EMAGE:7547 EMAGE:7547 EMAGE:7547 EMAGE:7547
euxassay_005209_05 euxassay_005209_06 euxassay_005209_07 euxassay_005209_08 euxassay_005209_09
EMAGE:7547 EMAGE:7547 EMAGE:7547 EMAGE:7547 EMAGE:7547
euxassay_005209_10 euxassay_005209_11 euxassay_005209_12 euxassay_005209_13 euxassay_005209_14
EMAGE:7547 EMAGE:7547 EMAGE:7547 EMAGE:7547 EMAGE:7547
euxassay_005209_15 euxassay_005209_16 euxassay_005209_17 euxassay_005209_18 euxassay_005209_19
EMAGE:7547 EMAGE:7547
euxassay_005209_20 euxassay_005209_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7547Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7547_wholemount_strong.wlz
7547_wholemount_moderate.wlz
7547_wholemount_weak.wlz
7547_wholemount_possible.wlz
7547_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7547_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
olfactory lobe
moderate moderate
regionalmoderate expression: see section 12 13
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 13 14
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 06 weak expression: see section 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 14 15 16 17 18 weak expression: see section 03 19
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 16
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 14
spinal cord
moderate moderate
regionalmoderate expression: see section 10 11 12
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 12 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T5819
Entity Detected:Atp6v1f, ATPase, H+ transporting, lysosomal V1 subunit F ( MGI:1913394)
Sequence:sense strand is shown

>T5819
CGGACGCGTGGGCGGACGCGTGGGTCGTCTGCCCGGCGGACAGGATGGCGGGCAGAGGTAAGCTAATCGC
GGTGATTGGAGACGAGGACACGGTGACTGGTTTCCTGTTGGGCGGCATAGGGGAGCTAAACAAGAACCGC
CACCCTAATTTCCTGGTAGTGGAGAAGGATACCACCATCAATGAGATCGAAGACACTTTCAGGCAATTTC
TAAACAGGGATGACATTGGCATCATTCTCATCAACCAGTACATCGCAGAGATGGTTCGGCACGCCCTGGA
TGCCCACCAGAGGTCCATTCCAGCTGTCCTGGAGATCCCGTCCAAGGAGCATCCCTACGATGCAGCCAAA
GACTCCATCCTGCGCAGGGCCAAGGGCATGTTCACCGCTGAAGACCTGCGCTAGGGCTGCTCAGCCCTCA
GCCCTCCTCATCACCAGGCCTCTCCTGGTTTGCCATGCTCTATTTAAGTGTCAAGCCTTGGTTTCCAGCC
CCTCCCTTCCTCTTCACTGAGTGGCTCGTAAGCTGTTGGGGTTCGGTTGTTCAGGTCTAGGCTGGGTAGA
GAAAGAAAGCCCAACTGTTTCTCCACTGCCTCCTCCCTGTGCTGTTAATAGTATCGTTGTTGATATTAAA
GGAATTATTCTCTCCAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:2812592 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:2812592 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7548 same embryo
 EMAGE:7551 same embryo
 EMAGE:7549 same embryo
 EMAGE:7550 same embryo
 EurExpress:euxassay_005209 same experiment
 MGI:4823335 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS