Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7737

Mrpl54 mitochondrial ribosomal protein L54 ( MGI:1913297)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7737 EMAGE:7737 EMAGE:7737 EMAGE:7737 EMAGE:7737
"Pseudo-wholemount" of euxassay_007426. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007426_01 euxassay_007426_02 euxassay_007426_03 euxassay_007426_04
EMAGE:7737 EMAGE:7737 EMAGE:7737 EMAGE:7737 EMAGE:7737
euxassay_007426_05 euxassay_007426_06 euxassay_007426_07 euxassay_007426_08 euxassay_007426_09
EMAGE:7737 EMAGE:7737 EMAGE:7737 EMAGE:7737 EMAGE:7737
euxassay_007426_10 euxassay_007426_11 euxassay_007426_12 euxassay_007426_13 euxassay_007426_14
EMAGE:7737 EMAGE:7737 EMAGE:7737 EMAGE:7737 EMAGE:7737
euxassay_007426_15 euxassay_007426_16 euxassay_007426_17 euxassay_007426_18 euxassay_007426_19
EMAGE:7737 EMAGE:7737 EMAGE:7737 EMAGE:7737 EMAGE:7737
euxassay_007426_20 euxassay_007426_21 euxassay_007426_22 euxassay_007426_23 euxassay_007426_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7737Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7737_wholemount_strong.wlz
7737_wholemount_moderate.wlz
7737_wholemount_weak.wlz
7737_wholemount_possible.wlz
7737_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7737_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 19 20 21 22 23 24
submandibular gland primordium
weak weak
regionalweak expression: see section 06 07 08 09 16 17 18 19 20
diencephalon lateral wall mantle layer
strong strong
spottedstrong expression: see section 12 13 moderate expression: see section 11 14
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 09 10 16 17
pons mantle layer
moderate moderate
regionalmoderate expression: see section 08 18 weak expression: see section 07
midbrain ventricular layer
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16
ventral grey horn
moderate moderate
regionalmoderate expression: see section 11 12 weak expression: see section 13 14 15 16
cervical ganglion
moderate moderate
regionalmoderate expression: see section 09 17
mandible
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 15 16 17 18 19 20 21 22 23
maxilla
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 16 17 18 19 20
palatal shelf
moderate moderate
regionalmoderate expression: see section 07 08 09 16 17
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 21 22 23 24 moderate expression: see section 06 07 20
clavicle
moderate moderate
regionalmoderate expression: see section 08 09 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T9069
Entity Detected:Mrpl54, mitochondrial ribosomal protein L54 ( MGI:1913297)
Sequence:sense strand is shown

>T9069
CGAGCGGCCGGCCAGCGTCATGGCGGCCGCCCATCTCCTCCGGGCTTCCCGGGTGTGGGCCCGCTGGCAT
CCCCGGGCGCTCCCGGTCCTCAGAAGACCTGGAGGATTCTCTATCCGGGAATATGCTAAAAAGCCAGTTG
GCAAGGGCGGCAAGGGCGGCGTGGCCGCTGAGGCCCTGAAGGACCCCGAGGTGTGCACAGACCCCACTCA
GCTCACCACACATGCCATGGGGGTCAACATCTACAAGGAAGGCCAGGATGTGGCCCTGAAGGCAGACTCC
GAGTACCCCACATGGCTGTTCCAGGTGAACTTGGGTCCCCCCAAAAAGCTAGAGGAACTAGAACCAGAGT
CCCGAGAGTACTGGCGACTACTTCGCAAACAGAATATCTGGCGCCACAACCGGCTGAGCAAGAACAAGAA
GCTGTAGTGTGATGATGGGCACCTGACGGGAGACTGCCTGGAACCCTGGCCAGCCAGAGCAGGGAGAGAA
CTGAGTCCTCTGACCTTCACCTGCTCGCCATGCCGTGCAGGTCATGCACACTCGAAATAAATACCAAAGG
GACCTACAGCAGCCACGCAAAAAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:6818054 using vector (pYX-Asc) specific primers. Forward Primer - name:RZPD T3, sequence:ATTAACCCTCACTAAAGGGA; Reverse Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:6818054 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7738 same embryo
 EMAGE:7740 same embryo
 EMAGE:7739 same embryo
 EMAGE:7736 same embryo
 EurExpress:euxassay_007426 same experiment
 MGI:4826451 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS