Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7821

Ryr1 ryanodine receptor 1, skeletal muscle ( MGI:99659)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7821 EMAGE:7821 EMAGE:7821 EMAGE:7821 EMAGE:7821
"Pseudo-wholemount" of euxassay_007404. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007404_01 euxassay_007404_02 euxassay_007404_03 euxassay_007404_04
EMAGE:7821 EMAGE:7821 EMAGE:7821 EMAGE:7821 EMAGE:7821
euxassay_007404_05 euxassay_007404_06 euxassay_007404_07 euxassay_007404_08 euxassay_007404_09
EMAGE:7821 EMAGE:7821 EMAGE:7821 EMAGE:7821 EMAGE:7821
euxassay_007404_10 euxassay_007404_11 euxassay_007404_12 euxassay_007404_13 euxassay_007404_14
EMAGE:7821 EMAGE:7821 EMAGE:7821 EMAGE:7821 EMAGE:7821
euxassay_007404_15 euxassay_007404_16 euxassay_007404_17 euxassay_007404_18 euxassay_007404_19
EMAGE:7821 EMAGE:7821 EMAGE:7821
euxassay_007404_20 euxassay_007404_21 euxassay_007404_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7821Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7821_wholemount_strong.wlz
7821_wholemount_moderate.wlz
7821_wholemount_weak.wlz
7821_wholemount_possible.wlz
7821_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7821_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
moderate moderate
regionalmoderate expression: see section 01 21 22
upper leg muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 16 17 18 19 20 21
diaphragm
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 11 12 13 14 15 16 17 18 19 20 21 22
shoulder rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 21
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 02 03 16 17 18
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01 20 21 22
not examined not examined
regionalnot examined expression: see section 02 03
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 07 08 13 14
pons mantle layer
weak weak
regionalweak expression: see section 06 15
tongue muscle
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35290
Entity Detected:Ryr1, ryanodine receptor 1, skeletal muscle ( MGI:99659)
Sequence:sense strand is shown

>T35290
GGGGTGAACTGGAAGTACAGAGAGTGAAATTCTTGAACTACTTGTCGAGGAATTTCTACACACTGCGGTT
CCTGGCCCTCTTCCTGGCCTTTGCCATCAACTTCATCTTACTGTTTTATAAGGTCTCAGACTCTCCACCA
GGGGAGGATGACATAGAAGGTTCCGGTGCTGGGGACATGTCAGGGGCAGGGTCTGGTGATGGCTCTGGCT
GGGGCTCCAGGGCCGGCGAGGAGGTAGAGGGCGATGAAGATGAGAACATGGTGTACTACTTCCTGGAGGA
GAGCACCGGCTACATGGAGCCTGCCCTGAGGTGCTTGAGCCTGCTGCACACGCTGGTGGCCTTTCTCTGC
ATCATTGGCTACAACTGTCTCAAGGTGCCCCTTGTCATCTTCAAGCGGGAGAAGGAGCTGGCCCGGAAGC
TGGAGTTTGATGGCCTCTACATTACAGAGCAGCCCGAGGATGATGACGTGAAGGGACAGTGGGACCGCCT
GGTGCTCAACACGCCGTCTTTCCCTAGCAACTACTGGGACAAGTTTGTCAAGCGGAAGGTTCTGGACAAA
CACGGGGACATCTTTGGGCGGGAGCGGATTGCGGAGCTGCTGGGCATGGATCTGGCCTCTCTGGAGATCA
CAGCCCACAATGAGCGCAAACCTGACCCTCCACCGGGCCTGCTGACATGGATCATGTCTATCGATGTCAA
ATACCAGATCTGGAAGTTTGGAGTCATCTTCACAGACAACTCTTTCCTGTATCTGGGCTGGTACATGGTG
ATGTCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 89651. Forward Primer - name:089651_F_cDNA_Ryr1, sequence:GGGGTGAACTGGAAGTACAGAG; Reverse Primer - name:089651_N_SP6_cDNA_Ryr1, sequence:GGACATCACCATGTACCAGCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7822 same embryo
 EMAGE:7824 same embryo
 EMAGE:7826 same embryo
 EMAGE:7825 same embryo
 EMAGE:7823 same embryo
 EurExpress:euxassay_007404 same experiment
 MGI:4827845 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS