Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7850

Atp8b2 ATPase, class I, type 8B, member 2 ( MGI:1859660)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7850 EMAGE:7850 EMAGE:7850 EMAGE:7850 EMAGE:7850
"Pseudo-wholemount" of euxassay_007731. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007731_01 euxassay_007731_02 euxassay_007731_03 euxassay_007731_04
EMAGE:7850 EMAGE:7850 EMAGE:7850 EMAGE:7850 EMAGE:7850
euxassay_007731_05 euxassay_007731_06 euxassay_007731_07 euxassay_007731_08 euxassay_007731_09
EMAGE:7850 EMAGE:7850 EMAGE:7850 EMAGE:7850 EMAGE:7850
euxassay_007731_10 euxassay_007731_11 euxassay_007731_12 euxassay_007731_13 euxassay_007731_14
EMAGE:7850 EMAGE:7850 EMAGE:7850 EMAGE:7850 EMAGE:7850
euxassay_007731_15 euxassay_007731_16 euxassay_007731_17 euxassay_007731_18 euxassay_007731_19
EMAGE:7850 EMAGE:7850 EMAGE:7850 EMAGE:7850 EMAGE:7850
euxassay_007731_20 euxassay_007731_21 euxassay_007731_22 euxassay_007731_23 euxassay_007731_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7850Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7850_wholemount_strong.wlz
7850_wholemount_moderate.wlz
7850_wholemount_weak.wlz
7850_wholemount_possible.wlz
7850_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7850_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 16 17 18 19 20 21 22 23 24
forearm mesenchyme
strong strong
regionalstrong expression: see section 01 02
upper arm mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 22 23 24
hand
strong strong
regionalstrong expression: see section 01
foot
strong strong
regionalstrong expression: see section 06 07 22 23 24
lower leg mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06
upper leg mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 21 22 23 24
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 13 14
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 08 09 10 12 13 16
pons mantle layer
strong strong
regionalstrong expression: see section 08 11
ventral grey horn
strong strong
regionalstrong expression: see section 11 12 13 14 15 16
otic capsule
strong strong
regionalstrong expression: see section 06 07 08 09 10 19 20 moderate expression: see section 16 17 18
nasal septum
strong strong
regionalstrong expression: see section 14
viscerocranium
strong strong
regionalExpression in the turbinate bone.
mandible
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
maxilla
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 16 17 18 19 20 21 22 23
bladder
strong strong
regionalstrong expression: see section 13 14 15 16
seminiferous cord
strong strong
regionalstrong expression: see section 06 07 08 20 21 22 23
axial skeleton
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
basioccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 11 12 13 14 15 16 17 18 19 20 21 22 23 24
basisphenoid bone
strong strong
regionalstrong expression: see section 11 12 13 14 15
temporal bone petrous part
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 20 21 22 23 24
vault of skull
strong strong
regionalstrong expression: see section 01 02 24
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 18 19 20 21 22 23 24
clavicle
strong strong
regionalstrong expression: see section 06 07 08 09 10 17 18 19 20
sternum
strong strong
regionalstrong expression: see section 13 14 15
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 08 09 10 11 18 19
tail paraxial mesenchyme
strong strong
regionalstrong expression: see section 12 13 14 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35966
Entity Detected:Atp8b2, ATPase, class I, type 8B, member 2 ( MGI:1859660)
Sequence:sense strand is shown

>T35966
CAGAGCCTGTTGACTTCTCCTTTAATCCACTGGCTGACAAGAAATTCTTGTTTTGGGACTCGAGTCTCTT
GGAGGCCGTCAAGATGGGGGACCCACACACGCACGAGTTCTTCCGTCTCCTCTCCTTGTGTCACACTGTC
ATGTCAGAAGAAAAGAACGAAGGAGAGCTGTACTACAAAGCTCAGTCTCCAGATGAGGGCGCTCTGGTCA
CCGCAGCCAGGAATTTTGGTTTTGTGTTCCGCTCTCGTACCCCTAAAACAATCACTGTCCATGAGCTCGG
TACAGCCATCACCTACCAGCTGCTGGCCATCTTGGACTTCAACAACATTCGCAAGCGGATGTCAGTCATA
GTTCGGAATCCAGAGGGGAAGATACGACTCTACTGCAAAGGGGCTGACACAATCCTGCTAGACAGGCTCC
ACCCTCCTACCCAGGAGCTGCTCAGCAGCACCACTGACCATCTGAATGAGTATGCAGGGGACGGGCTGAG
GACCCTGGTGTTGGCCTACAAAGACCTGGATGAAGAGTACTATGAGGAGTGGGCCAGGAGACGCCTCCAG
GCTAGCCTGGCCCAAGACAGCCGAGAGGACAGGCTAGCCAGCATCTATGAAGAGGTTGAGAGTGACATGA
TGCTGCTGGGTGCCACGGCCATTGAGGACAAGCTTCAGCAGGGAGTCCCAGAGACCATTGCCCTCTTGAC
TCTGGCCAACATCAAGATTTGGGTGCTAACAGGAGATAAGCAAGAGACAGCTGTGAACATTGGCTACTCC
TGTAAGATGCTGACTGACGACATGACAGAGGTGTTTGTAGTCACAGGCCACACTGTCCTGGAGGTGCGAG
AGGAGCTGAGGAAAGCCCGGAAGAAGATGGTAGATTCCTCCCACGCTGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 77342. Forward Primer - name:077342_F_cDNA_Atp8b2, sequence:CAGAGCCTGTTGACTTCTCCTT; Reverse Primer - name:077342_N_SP6_cDNA_Atp8b2, sequence:CACAGCGTGGGAGGAATCTAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7851 same embryo
 EMAGE:7849 same embryo
 EMAGE:7848 same embryo
 EMAGE:6094 same embryo
 EMAGE:6095 same embryo
 EurExpress:euxassay_007731 same experiment
 MGI:4823345 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS