Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7878

Tmem145 transmembrane protein 145 ( MGI:3607779)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7878 EMAGE:7878 EMAGE:7878 EMAGE:7878 EMAGE:7878
"Pseudo-wholemount" of euxassay_012829. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012829_01 euxassay_012829_02 euxassay_012829_03 euxassay_012829_04
EMAGE:7878 EMAGE:7878 EMAGE:7878 EMAGE:7878 EMAGE:7878
euxassay_012829_05 euxassay_012829_06 euxassay_012829_07 euxassay_012829_08 euxassay_012829_09
EMAGE:7878 EMAGE:7878 EMAGE:7878 EMAGE:7878 EMAGE:7878
euxassay_012829_10 euxassay_012829_11 euxassay_012829_12 euxassay_012829_13 euxassay_012829_14
EMAGE:7878 EMAGE:7878 EMAGE:7878 EMAGE:7878 EMAGE:7878
euxassay_012829_15 euxassay_012829_16 euxassay_012829_17 euxassay_012829_18 euxassay_012829_19
EMAGE:7878 EMAGE:7878 EMAGE:7878 EMAGE:7878
euxassay_012829_20 euxassay_012829_21 euxassay_012829_22 euxassay_012829_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7878Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7878_wholemount_strong.wlz
7878_wholemount_moderate.wlz
7878_wholemount_weak.wlz
7878_wholemount_possible.wlz
7878_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7878_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
homogeneousmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 weak expression: see section 08 19
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 05 21 22 23 weak expression: see section 03 04 07 08 09 10 11 12 13 14 15 16 17 18 19
olfactory cortex marginal layer
weak weak
regionalweak expression: see section 11 12 16 17 18
medulla oblongata alar plate mantle layer
moderate moderate
homogeneousmoderate expression: see section 07 09 10 11 14 15 16 17 weak expression: see section 08 12 13
medulla oblongata basal plate mantle layer
moderate moderate
homogeneousmoderate expression: see section 07 09 10 11 14 15 16 17 weak expression: see section 06 08 12 13
rest of cerebellum mantle layer
moderate moderate
homogeneousmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 weak expression: see section 04 05 06 07 08 19 20 21
pons mantle layer
moderate moderate
homogeneousmoderate expression: see section 07 09 10 11 14 15 16 17 18 19 weak expression: see section 06 08 12 13
midbrain mantle layer
moderate moderate
homogeneousmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 weak expression: see section 06 07 08 19 20
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 21 weak expression: see section 19 20
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 07 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 21 weak expression: see section 03 04 06 07 08 09 17 18 19 20 22
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 06 07 17
spinal cord mantle layer
moderate moderate
homogeneousmoderate expression: see section 09 10 11 14 weak expression: see section 08 12 13
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 09 10 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38179
Entity Detected:Tmem145, transmembrane protein 145 ( MGI:3607779)
Sequence:sense strand is shown

>T38179
GCTGCAGTTGGAGTATGAGATGGTCCTTACCAACGGCAAGTCTTTCTGGACACGGCACTTCTCAGCTGAT
GAATTTGGGATTTTGGAGACAGATGTGACCTTTCTCCTCATCTTCACCCTTATCTTTGTCCTCTCTTGTT
ACTTTGGATATTTGCTGAAAGGCCGTCAGTTACTCCACACAACTTATAAAATGTTCATGGCTGCAGCAGG
AGTGGAGGTCCTGAGCCTCCTGTTTTTCTGCATCTACTGGGGCCAGTATGCCACAGATGGCATTGGCAAT
GGCAGCGTGAAGATCTTGGCCAAGCTGCTCTTCTCCTCCAGTTTCCTCATCTTCCTGCTCACACTCATCC
TCCTCGGGAAGGGATTCACGGTGACACGAGGCCGCATCAGCCACTCAGGCTCCGTGAAGTTGTCTGTGTA
CATGACCCTGTACACCCTCACCCACGTGGTGTTGCTCATCTACGAGGCAGAATTCTTTGACCCAGGCCAG
GTACTATACACATACGAGTCTCCGGCTGGTTATGGGCTCATCGGGCTGCAGGTGGCTGCCTATGTGTGGT
TCTGCTATGCTGTGCTGGTCTCCCTTCGGCACTATCCAGAGAAGCAGCCCTTTTATGTGCCCTTCTTTGC
TGCCTATACTCTCTGGTTCTTCGCTGTCCCCGTCATGGCTCTGATCGCCAATTTTGGGATCCCAAAGTGG
GCCCGAGAGAAGATAGTCAACGGTATCCAGCTGGGGATCCACCTCTATGCCCATGGCGTGTTTCTGATCA
TGACCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 105762. Forward Primer - name:105762_F_cDNA_B930076A02, sequence:GCTGCAGTTGGAGTATGAGATG; Reverse Primer - name:105762_N_SP6_cDNA_B930076A02, sequence:GGGTCATGATCAGAAACACGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7881 same embryo
 EMAGE:7877 same embryo
 EMAGE:7879 same embryo
 EMAGE:7880 same embryo
 EMAGE:7876 same embryo
 EurExpress:euxassay_012829 same experiment
 MGI:4828776 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS