Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8265

1300001I01Rik RIKEN cDNA 1300001I01 gene ( MGI:1921398)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8265 EMAGE:8265 EMAGE:8265 EMAGE:8265 EMAGE:8265
"Pseudo-wholemount" of euxassay_007554. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007554_01 euxassay_007554_02 euxassay_007554_03 euxassay_007554_04
EMAGE:8265 EMAGE:8265 EMAGE:8265 EMAGE:8265 EMAGE:8265
euxassay_007554_05 euxassay_007554_06 euxassay_007554_07 euxassay_007554_08 euxassay_007554_09
EMAGE:8265 EMAGE:8265 EMAGE:8265 EMAGE:8265 EMAGE:8265
euxassay_007554_10 euxassay_007554_11 euxassay_007554_12 euxassay_007554_13 euxassay_007554_14
EMAGE:8265 EMAGE:8265 EMAGE:8265 EMAGE:8265 EMAGE:8265
euxassay_007554_15 euxassay_007554_16 euxassay_007554_17 euxassay_007554_18 euxassay_007554_19
EMAGE:8265 EMAGE:8265 EMAGE:8265 EMAGE:8265
euxassay_007554_20 euxassay_007554_21 euxassay_007554_22 euxassay_007554_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8265Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8265_wholemount_strong.wlz
8265_wholemount_moderate.wlz
8265_wholemount_weak.wlz
8265_wholemount_possible.wlz
8265_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8265_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
pectoral girdle and thoracic body wall musculature
moderate moderate
regionalmoderate expression: see section 03 04 05 18 19 20
adrenal gland
moderate moderate
regionalmoderate expression: see section 06 07 08 14 15 16 17
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 15 16 17 18 19
anterior naris
moderate moderate
regionalmoderate expression: see section 13 14 15 16
external naris
moderate moderate
regionalmoderate expression: see section 16
stomach
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08
midgut
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
kidney calyx
moderate moderate
regionalmoderate expression: see section 06 15 16 17 weak expression: see section 07 08
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35356
Entity Detected:1300001I01Rik, RIKEN cDNA 1300001I01 gene ( MGI:1921398)
Sequence:sense strand is shown

>T35356
GCTCTGAGTACCTCAAGTGCCTGACCCAGCAGGCTGTGGCCCTGCAGCGCACCATGAATGAGATCTACCG
TAATGGCTCCAGTGCCAATATCCCACCCCTCAAGTTCACAGCTCCCAGCATGACCAGTGTCCTGGAGCAG
CTCAATGTCATCAATGGCATCCTCTTCATTCCTCTCAGCCAAAAAGACTTGGAAAACCTGAAGGCAGAGG
TGGCACGGCGACACCAGCTCCAAGAGGCCAACAGAAACAGGGATAAGGCTGAAGAACAACCCATGGCCCC
CGAGCCTGAGCCTGAGCCAGAGAGAGCCGTGGAGGACATGGGCTCCCCTCAGACTGCCAAGGAAGGTCCT
TCTTCCCTGAACTTACAGGGATAAAAAAAGAAAGAAAGATGGACAGTCCAGCAGCCCCATTACCCGGCGA
TGCAGACAGATTCCAGGAGAATTCTGGGGGCGTGCCCTGCAGATTGGGAGAGGAAGCTAGTCCTCAACTT
TATACCCCCACCTCACCCCACCATCTGCCTGGGGCCCTGCCCTGGTTTGCCTGCCCCTAAAAGATGGTTT
TGCACTGGTTCAATGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 87546. Forward Primer - name:087546_F_cDNA_1300001I01Rik, sequence:GCTCTGAGTACCTCAAGTGCCT; Reverse Primer - name:087546_N_SP6_cDNA_1300001I01Rik, sequence:TCATTGAACCAGTGCAAAACC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8266 same embryo
 EMAGE:8267 same embryo
 EurExpress:euxassay_007554 same experiment
 MGI:4822604 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS