Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8314

Nxph1 neurexophilin 1 ( MGI:107492)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8314 EMAGE:8314 EMAGE:8314 EMAGE:8314 EMAGE:8314
"Pseudo-wholemount" of euxassay_007637. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007637_01 euxassay_007637_02 euxassay_007637_03 euxassay_007637_04
EMAGE:8314 EMAGE:8314 EMAGE:8314 EMAGE:8314 EMAGE:8314
euxassay_007637_05 euxassay_007637_06 euxassay_007637_07 euxassay_007637_08 euxassay_007637_09
EMAGE:8314 EMAGE:8314 EMAGE:8314 EMAGE:8314 EMAGE:8314
euxassay_007637_10 euxassay_007637_11 euxassay_007637_12 euxassay_007637_13 euxassay_007637_14
EMAGE:8314 EMAGE:8314 EMAGE:8314 EMAGE:8314 EMAGE:8314
euxassay_007637_15 euxassay_007637_16 euxassay_007637_17 euxassay_007637_18 euxassay_007637_19
EMAGE:8314
euxassay_007637_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8314Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8314_wholemount_strong.wlz
8314_wholemount_moderate.wlz
8314_wholemount_weak.wlz
8314_wholemount_possible.wlz
8314_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8314_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 08 11
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 08 10 11 12 13 14 15
telencephalon mantle layer
moderate moderate
single cellmoderate expression: see section 01 02 03 04 07 08 11 14 15 17 18 19 20 weak expression: see section 05
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15
dorsal grey horn
moderate moderate
regionalmoderate expression: see section 11 12 13 14
ventral grey horn
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36715
Entity Detected:Nxph1, neurexophilin 1 ( MGI:107492)
Sequence:sense strand is shown

>T36715
ATAGGACAGGGCTGTCACCTTAAGGAAGAAGGTCACATCTGTTGCCTGGAATGTGTCTACCTTGCTGCTC
TTGTTGACTGGTGCACACATGCTAGTGGAAAACAATTGATGTCATTTCTGCACAGTCAGCTTCATCTCTC
AGCATAGTTGTAAATCACCATAGATCTCAGAGTCTCATCTGAAGACATGCTGTCACGAATAGAGGCCCAT
GAGCATCCATTCTTGCACATTTCAGCTCACATCTATCATGGTTCCCTGTGAGAGAGCTTTCATTGTCTGA
CTCATGATGGTTCAGGACAAACTATGATCAAACAAAAAGAATTAACTAGACAGAGGATGTGTCTAACATG
CTGTTACGGAAATCTCTTTTAAGGTCTTGAGTCCATGCTAATCGATAATCCCCACTCATGCATTCCTACT
GCTTGGAGTAGCTGTGCTGGTGAATACTACTGTAGGAGTTATATGCTTGTTAAATGGAAAAAAATGTGTC
TTTAGAGCTCAGTATTCTTTATTTTATGAACACAACACAGTGTAGTAGCTTTTTCCCAGCATACAGTAGA
CACATTCAAGGTGATACAGGGTGGCTTTTCTTTCTATGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 73092. Forward Primer - name:073092_F_cDNA_Nxph1, sequence:ATAGGACAGGGCTGTCACCTTA; Reverse Primer - name:073092_N_SP6_cDNA_Nxph1, sequence:CCATAGAAAGAAAAGCCACCCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8315 same embryo
 EMAGE:8318 same embryo
 EMAGE:8313 same embryo
 EMAGE:8317 same embryo
 EMAGE:8316 same embryo
 EurExpress:euxassay_007637 same experiment
 MGI:4826840 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS