Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8320

Orc6 origin recognition complex, subunit 6 ( MGI:1929285)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8320 EMAGE:8320 EMAGE:8320 EMAGE:8320 EMAGE:8320
"Pseudo-wholemount" of euxassay_007673. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007673_01 euxassay_007673_02 euxassay_007673_03 euxassay_007673_04
EMAGE:8320 EMAGE:8320 EMAGE:8320 EMAGE:8320 EMAGE:8320
euxassay_007673_05 euxassay_007673_06 euxassay_007673_07 euxassay_007673_08 euxassay_007673_09
EMAGE:8320 EMAGE:8320 EMAGE:8320 EMAGE:8320 EMAGE:8320
euxassay_007673_10 euxassay_007673_11 euxassay_007673_12 euxassay_007673_13 euxassay_007673_14
EMAGE:8320 EMAGE:8320 EMAGE:8320 EMAGE:8320 EMAGE:8320
euxassay_007673_15 euxassay_007673_16 euxassay_007673_17 euxassay_007673_18 euxassay_007673_19
EMAGE:8320 EMAGE:8320 EMAGE:8320
euxassay_007673_20 euxassay_007673_21 euxassay_007673_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8320Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8320_wholemount_strong.wlz
8320_wholemount_moderate.wlz
8320_wholemount_weak.wlz
8320_wholemount_possible.wlz
8320_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8320_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 05 06 07 08 14 15 16 17
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 08 09 10 13 14 15
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
mandible
moderate moderate
regionalmoderate expression: see section 02 03 20 21
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 13 14
lower jaw molar
moderate moderate
regionalmoderate expression: see section 05 06 17 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 13 14
upper jaw molar
moderate moderate
regionalmoderate expression: see section 05 06 17 18
liver left lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 18 weak expression: see section 12 13 14 15 16 17
liver right lobe
moderate moderate
regionalmoderate expression: see section 19 20 21 22
renal cortex
moderate moderate
regionalmoderate expression: see section 04 05 06 07 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36724
Entity Detected:Orc6, origin recognition complex, subunit 6 ( MGI:1929285)
Sequence:sense strand is shown

>T36724
AGTCTGTCTGCACGTAGCTCAGAAACCAGCAATGCTGTCATATGCCTGGACCTTGCAGCTTCCTGTAGGA
AGTGCCCCTTGGATAGAGCATATTTAATTAGGCTCTCTGGTTTGAACAAGATGATGTATCAGAGCTGTCT
TAAATCTTTTGAGTGTTTACTAGGATTAAATTCAAATGTTGGAATAAGAGACCTAGCTGTACAGTTCAGC
TGTACAGAAGCAGTGAACTTGGCTGCAGAGATACTGCAGAGCTACAAGTCTGGTCTTCCTGAAACACAGC
GAGCAGATCTTGACTTGTCCAGGCCACTTTTCACCACTGCCGCACTACTCTCAGCATGCAAAATTCTAAA
GATAAAGGTGGATAAAACCAAAATGATAACTACATCCGGTGTGAAAAAGGCAATACTTGATCGACTGTGT
AAGCAGTTAGAAAAGATTGGGCAGCAGATTAACAGAGACTCTGCAGATTTAGCTAGACCAGCACTGAAGA
GAAAGAAGCCAGAGTTTAGTCCAACACTGAAGAAAAAGGAGCCAGGACTTGAACCACCAGCAAAAGAAAT
AGAAGTAATAGAAACCCTTCATAAACTACCTAAAGATGAAGATCTGACACAGGATTATGAAGAATGGAAA
AGGAAGATTTTGGAAAATGCTGCCAAAGCTCAGACAGCCACAGCAGAGTGATTTCCATCTCACTGCAGGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 100504. Forward Primer - name:100504_F_cDNA_Orc6l, sequence:AGTCTGTCTGCACGTAGCTCAG; Reverse Primer - name:100504_N_SP6_cDNA_Orc6l, sequence:GCCTGCAGTGAGATGGAAATC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8321 same embryo
 EMAGE:8324 same embryo
 EMAGE:8319 same embryo
 EMAGE:8322 same embryo
 EMAGE:8323 same embryo
 EurExpress:euxassay_007673 same experiment
 MGI:4826984 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS