Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8347

Phactr2 phosphatase and actin regulator 2 ( MGI:2446138)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8347 EMAGE:8347 EMAGE:8347 EMAGE:8347 EMAGE:8347
"Pseudo-wholemount" of euxassay_007706. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007706_01 euxassay_007706_02 euxassay_007706_03 euxassay_007706_04
EMAGE:8347 EMAGE:8347 EMAGE:8347 EMAGE:8347 EMAGE:8347
euxassay_007706_05 euxassay_007706_06 euxassay_007706_07 euxassay_007706_08 euxassay_007706_09
EMAGE:8347 EMAGE:8347 EMAGE:8347 EMAGE:8347 EMAGE:8347
euxassay_007706_10 euxassay_007706_11 euxassay_007706_12 euxassay_007706_13 euxassay_007706_14
EMAGE:8347 EMAGE:8347 EMAGE:8347 EMAGE:8347 EMAGE:8347
euxassay_007706_15 euxassay_007706_16 euxassay_007706_17 euxassay_007706_18 euxassay_007706_19
EMAGE:8347 EMAGE:8347 EMAGE:8347 EMAGE:8347
euxassay_007706_20 euxassay_007706_21 euxassay_007706_22 euxassay_007706_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8347Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8347_wholemount_strong.wlz
8347_wholemount_moderate.wlz
8347_wholemount_weak.wlz
8347_wholemount_possible.wlz
8347_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8347_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
body cavity or lining
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
limb
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
gland
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
alimentary system
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
integumental system
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 14
diencephalon roof plate
moderate moderate
regionalmoderate expression: see section 10 11 12
choroid invagination
moderate moderate
regionalmoderate expression: see section 06 07 08 09 13 14 15 16 17 18 19
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
metencephalon part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 13
sensory organ system
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
cardiovascular system
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
urinary system
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
reproductive system
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
respiratory system
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
tail
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36779
Entity Detected:Phactr2, phosphatase and actin regulator 2 ( MGI:2446138)
Sequence:sense strand is shown

>T36779
CTCACACCAGAGGAGACTGTTGCTGGAGCAGAGGAGCAGGCCACAAGCAAATCCAAGGCGGCCATCGCTC
TGCCACCTAGCACAGCACCACCATCCCCACCTGCCCTTCTTCTGCCCCCTGAAGATCAGTGCACTATTGC
CTTGGACACTCCCATGGTCCTAGTCAGTGATGGACCTACCCTGCCCGTCTCTGCCTTAGACACAAGTCAG
CTCCTTTGGACTGAAGAACCATCGAGCAGAACCTCTCCGTACTCAAGCACTGGCTTAGGTGGGAGCAGAG
AACAGGCAAAATGTTTTACAACCAAAGATGAGCTGGGACCACAGTTACTGACCCCTGGGCAGATGGGAGA
CTCGTCAGAATCCTTCAGTGCCCCAGAAGATGAGGCCCCAAGAGAGTACCAAGCCAACGACTCTGACTCA
GATGGACCCATCTTGTACACTGATGATGATGATGAAGAAGATGATGATGATGACAGCAGTGGAGAAAGTG
CACTGGCAAGCAAGATAAGACGAAGGGATACACTTGCCATCAAACTTGGCAACAGACCGTCCAAGAAAGA
ACTGGAGGATAAAAACATCCTGCAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 82461. Forward Primer - name:082461_F_cDNA_Phactr2, sequence:CTCACACCAGAGGAGACTGTTG; Reverse Primer - name:082461_N_SP6_cDNA_Phactr2, sequence:GCTGCAGGATGTTTTTATCCTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8348 same embryo
 EMAGE:8349 same embryo
 EMAGE:8351 same embryo
 EMAGE:8350 same embryo
 EurExpress:euxassay_007706 same experiment
 MGI:4827181 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS