Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8353

Gigyf1 GRB10 interacting GYF protein 1 ( MGI:1888677)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8353 EMAGE:8353 EMAGE:8353 EMAGE:8353 EMAGE:8353
"Pseudo-wholemount" of euxassay_007703. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007703_01 euxassay_007703_02 euxassay_007703_03 euxassay_007703_04
EMAGE:8353 EMAGE:8353 EMAGE:8353 EMAGE:8353 EMAGE:8353
euxassay_007703_05 euxassay_007703_06 euxassay_007703_07 euxassay_007703_08 euxassay_007703_09
EMAGE:8353 EMAGE:8353 EMAGE:8353 EMAGE:8353 EMAGE:8353
euxassay_007703_10 euxassay_007703_11 euxassay_007703_12 euxassay_007703_13 euxassay_007703_14
EMAGE:8353 EMAGE:8353 EMAGE:8353 EMAGE:8353 EMAGE:8353
euxassay_007703_15 euxassay_007703_16 euxassay_007703_17 euxassay_007703_18 euxassay_007703_19
EMAGE:8353 EMAGE:8353 EMAGE:8353 EMAGE:8353 EMAGE:8353
euxassay_007703_20 euxassay_007703_21 euxassay_007703_22 euxassay_007703_23 euxassay_007703_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8353Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8353_wholemount_strong.wlz
8353_wholemount_moderate.wlz
8353_wholemount_weak.wlz
8353_wholemount_possible.wlz
8353_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8353_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 06 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 15 16 17 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06 16
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 16 17 18 19 20
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 15
spinal cord
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 14 15
cervical ganglion
moderate moderate
regionalmoderate expression: see section 07 15 16
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 14
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36771
Entity Detected:Gigyf1, GRB10 interacting GYF protein 1 ( MGI:1888677)
Sequence:sense strand is shown

>T36771
GTTGAGGGGACTGTCTCTGAGTCCTAGAATCAGTTCACCTCCTGGCCCACCTGGAGATCTAGAAGACGAA
GAAGGCTTGAAGCACTTGCAGCAGGAGGCAGAGAAGCTGGTGGCCTCCCTGCAGGACAGCTCCCTGGAGG
AGGAGCAGTTCACCGCTGCCATGCAAACCCAGGGCCTCCGCCACTCCACAGCTGCCACTGCCCTTCCCCT
CAGCCATGGCGCTGCCCGAAAGTGGTTCTACAAGGACCCACAGGGGGAAATCCAAGGCCCTTTCACGACC
CAGGAGATGGCTGAGTGGTTCCAGGCTGGCTACTTCTCCATGTCACTCTTAGTGAAGAGGGGCTGCGATG
AGGGTTTCCAGCCTCTGGGAGAGGTGATCAAGATGTGGGGCCGTGTGCCCTTTGCCCCAGGGCCCTCGCC
ACCCCCGCTGCTGGGCAACATGGATCAGGAGCGGCTGAAGAAGCAGCAGGAGCTGGCTGCGGCAGCCCTG
TACCAGCAGCTGCAGCACCAGCACTTTCTGCAGCTGGTTGGCAGCCGCCAGCTCCCGCAGTGTACGACGC
TCCGGGAAAAGGCAGCTATGGGGGACCTGACGCCGCCGCAGCAGCAGCAGCTCACTACGTTCCTGCAGCA
GCTCCAGGCTCTCAAAACCCCCAGAGGTGGAGACCAGAACCTGCTCCCGACGATGAGCCGGTCCTTGTCG
GTGCCAGATTCAGGCCCCCTCTGGGACTTACATACCTCAGCTTCATCACAGTCAGGTGGTGAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 66380. Forward Primer - name:066380_F_cDNA_Perq1, sequence:GTTGAGGGGACTGTCTCTGAGT; Reverse Primer - name:066380_N_SP6_cDNA_Perq1, sequence:CTCACCACCTGACTGTGATGAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8352 same embryo
 EMAGE:8357 same embryo
 EMAGE:8354 same embryo
 EMAGE:8356 same embryo
 EMAGE:8355 same embryo
 EurExpress:euxassay_007703 same experiment
 MGI:4825053 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS