Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8368

Pmfbp1 polyamine modulated factor 1 binding protein 1 ( MGI:1930136)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8368 EMAGE:8368 EMAGE:8368 EMAGE:8368 EMAGE:8368
"Pseudo-wholemount" of euxassay_009492. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009492_01 euxassay_009492_02 euxassay_009492_03 euxassay_009492_04
EMAGE:8368 EMAGE:8368 EMAGE:8368 EMAGE:8368 EMAGE:8368
euxassay_009492_05 euxassay_009492_06 euxassay_009492_07 euxassay_009492_08 euxassay_009492_09
EMAGE:8368 EMAGE:8368 EMAGE:8368 EMAGE:8368 EMAGE:8368
euxassay_009492_10 euxassay_009492_11 euxassay_009492_12 euxassay_009492_13 euxassay_009492_14
EMAGE:8368 EMAGE:8368 EMAGE:8368 EMAGE:8368 EMAGE:8368
euxassay_009492_15 euxassay_009492_16 euxassay_009492_17 euxassay_009492_18 euxassay_009492_19
EMAGE:8368 EMAGE:8368 EMAGE:8368
euxassay_009492_20 euxassay_009492_21 euxassay_009492_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8368Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8368_wholemount_strong.wlz
8368_wholemount_moderate.wlz
8368_wholemount_weak.wlz
8368_wholemount_possible.wlz
8368_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8368_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 moderate expression: see section 15
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 moderate expression: see section 15
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 06 07 08 09 10 12 13 14 15 16
pons mantle layer
strong strong
single cellstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17
midbrain mantle layer
strong strong
single cellstrong expression: see section 12 moderate expression: see section 05 06 07 08 09 10 11 13 14 15 16
trigeminal v ganglion
strong strong
regionalstrong expression: see section 01 02 03 04 05 15 16 17 18 19 20
ventral grey horn
strong strong
single cellstrong expression: see section 07 08 09 10 11 12 13
dorsal root ganglion
strong strong
single cellstrong expression: see section 05 06 07 08 10 11 12 13 14 15 16 17
neural retina
strong strong
single cellstrong expression: see section 01 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36809
Entity Detected:Pmfbp1, polyamine modulated factor 1 binding protein 1 ( MGI:1930136)
Sequence:sense strand is shown

>T36809
CTGCTTCAGAAGACACTGGATGAAGACGAGAAAAAGATAGATGAGCTATTTCACAGCACCCAAGTCTCTG
AGCAAAAGCAAAGGGAGCTAACAAACTCCATAAGGAAGCTAGAGGAGGAACTTCTGGAGATAAAAGGGCT
CTTGGAGGAGAAACGAGAGCAACTGAAGAAGAGTAAGGAACAGGAGAAGGCACTGGAGGAAGAGATCGAG
GCTTTGCGACAAGAAGCGAAAAGGAAAGAGAAGATGGCGAAGGAACATTTGAGAAAGCTGGATGAAGAGA
AGGAGAACCTGCAGGCTGAGTTGACCTCCCGTTCCTCACACCTGGACTCCTCTCTCAACAAATACAACTC
CTCCCAGAAAGTCATCCAAGAGCTCAACGCGGAGATAGCCCGCCAGAAGGATTCCATCATGATTCTGCAG
ACACAGCTGGATTCGGCTATCCAGAAAGAGAAGAACTGTTTCCAGAACATGGTTAGTAAAGAAGCTTATG
AGGAACTTGTGCGGAAGTCGGGCAACTGCCAGGACGACCTGACACAGGCCCTGGAGAAGCTCACTCAGGC
AACCTCAGAGACAAAGAGCCTGAATCGCTCCTTGCAACAGACCCAGGAGAGGAAAGCTCAACTGGAAGAT
GAAATCGCGGCTTATGAGGAAAGGATGAAAAAGCTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 100559. Forward Primer - name:100559_F_cDNA_Pmfbp1, sequence:CTGCTTCAGAAGACACTGGATG; Reverse Primer - name:100559_N_SP6_cDNA_Pmfbp1, sequence:GAGCTTTTTCATCCTTTCCTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8365 same embryo
 EMAGE:8364 same embryo
 EMAGE:8367 same embryo
 EMAGE:8366 same embryo
 EurExpress:euxassay_009492 same experiment
 MGI:4827295 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS