Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8408

Ptprk protein tyrosine phosphatase, receptor type, K ( MGI:103310)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8408 EMAGE:8408 EMAGE:8408 EMAGE:8408 EMAGE:8408
"Pseudo-wholemount" of euxassay_009627. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009627_01 euxassay_009627_02 euxassay_009627_03 euxassay_009627_04
EMAGE:8408 EMAGE:8408 EMAGE:8408 EMAGE:8408 EMAGE:8408
euxassay_009627_05 euxassay_009627_06 euxassay_009627_07 euxassay_009627_08 euxassay_009627_09
EMAGE:8408 EMAGE:8408 EMAGE:8408 EMAGE:8408 EMAGE:8408
euxassay_009627_10 euxassay_009627_11 euxassay_009627_12 euxassay_009627_13 euxassay_009627_14
EMAGE:8408 EMAGE:8408 EMAGE:8408 EMAGE:8408 EMAGE:8408
euxassay_009627_15 euxassay_009627_16 euxassay_009627_17 euxassay_009627_18 euxassay_009627_19
EMAGE:8408 EMAGE:8408 EMAGE:8408
euxassay_009627_20 euxassay_009627_21 euxassay_009627_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8408Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8408_wholemount_strong.wlz
8408_wholemount_moderate.wlz
8408_wholemount_weak.wlz
8408_wholemount_possible.wlz
8408_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8408_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
vibrissa
weak weak
regionalweak expression: see section 04 05 06 07 08 19 20
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 05 08 09 10 11
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 07 08 09 10 11 14 weak expression: see section 06 12 13
pons mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 07 08 09 11 15 16 weak expression: see section 02
pons marginal layer
moderate moderate
regionalmoderate expression: see section 10
midbrain mantle layer
weak weak
regionalweak expression: see section 03 04 05 07 08 09 10 11
ventral grey horn
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11
stomach
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09
midgut
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36923
Entity Detected:Ptprk, protein tyrosine phosphatase, receptor type, K ( MGI:103310)
Sequence:sense strand is shown

>T36923
AGGAGGGCTATCTGATGGTACAACAGTTCCAGTACCTAGGCTGGGCTTCTCATCGAGAAGTGCCTGGCTC
CAAACGCTCGTTTTTGAAATTGATACTGCAGGTGGAAAAATGGCAAGAGGAATGTGAAGAAGGGGAAGGC
CGGACAATCATCCACTGCTTGAATGGCGGTGGGCGCAGTGGCATGTTCTGTGCCATAGGCATTGTTGTGG
AGATGGTGAAGCGGCAAAATGTGGTGGATGTTTTCCATGCAGTAAAGACGCTGAGGAACAGCAAGCCAAA
CATGGTGGAAGCCCCGGAGCAGTATCGTTTTTGCTATGATGTGGCGTTAGAGTACCTGGAGTCCTCATAG
TTCGCTGAGACTATTTGCAGAGCATCCAAGCAGAAATCCATTCGTCTGTTGAGCCAGCAGCTGTTGTACC
TGTTACTGCACCGAGAGATTTTAATGTACGGGGTGGGAGGCTTTTACATTGGAGAGGCAAATGTATTTTT
CTTATAAAGTTGTGTATCTTAATAAAAAGGACTTGATCAGTTTCTGTGACTGTATGAGAGCATCCACATT
TCATGCCACCTAAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 74037. Forward Primer - name:074037_F_cDNA_Ptprk, sequence:AGGAGGGCTATCTGATGGTACA; Reverse Primer - name:074037_N_SP6_cDNA_Ptprk, sequence:ATTAGGTGGCATGAAATGTGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8407 same embryo
 EMAGE:8410 same embryo
 EMAGE:8406 same embryo
 EMAGE:8405 same embryo
 EMAGE:8409 same embryo
 EurExpress:euxassay_009627 same experiment
 MGI:4827528 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS