Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8534

Plxna4 plexin A4 ( MGI:2179061)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8534 EMAGE:8534 EMAGE:8534 EMAGE:8534 EMAGE:8534
"Pseudo-wholemount" of euxassay_009720. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009720_01 euxassay_009720_02 euxassay_009720_03 euxassay_009720_04
EMAGE:8534 EMAGE:8534 EMAGE:8534 EMAGE:8534 EMAGE:8534
euxassay_009720_05 euxassay_009720_06 euxassay_009720_07 euxassay_009720_08 euxassay_009720_09
EMAGE:8534 EMAGE:8534 EMAGE:8534 EMAGE:8534 EMAGE:8534
euxassay_009720_10 euxassay_009720_11 euxassay_009720_12 euxassay_009720_13 euxassay_009720_14
EMAGE:8534 EMAGE:8534 EMAGE:8534 EMAGE:8534 EMAGE:8534
euxassay_009720_15 euxassay_009720_16 euxassay_009720_17 euxassay_009720_18 euxassay_009720_19
EMAGE:8534 EMAGE:8534 EMAGE:8534 EMAGE:8534
euxassay_009720_20 euxassay_009720_21 euxassay_009720_22 euxassay_009720_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8534Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8534_wholemount_strong.wlz
8534_wholemount_moderate.wlz
8534_wholemount_weak.wlz
8534_wholemount_possible.wlz
8534_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8534_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 19 20 21 22 23
facial vii ganglion
weak weak
regionalweak expression: see section 03 04 05 18 19 20
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 05 06 18
trigeminal v ganglion
weak weak
regionalweak expression: see section 02 03 04 05 06 07 16 17 18 19 20 21
vagus x ganglion
weak weak
regionalweak expression: see section 07
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 10 16 17
cervical ganglion
weak weak
regionalweak expression: see section 08 16 17
thoracic ganglion
weak weak
regionalweak expression: see section 09 12 13
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 09 10 11 13 14 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36808
Entity Detected:Plxna4, plexin A4 ( MGI:2179061)
Sequence:sense strand is shown

>T36808
AGATCTTCTCCTATGTGGGCAAATACAGTGAGGAGATCCTTGGACCCCTGGACCATGATGACCAGTGTGG
AAAGCAGAAACTGGCTTACAAACTAGAACAAGTCATAACTCTCATGAGCTTAGACAGCTGAGAACTGTCC
TTCCAGGGCCATCCTGGAGGGAGGGACACACCAAGCCGTGCCTCAGTCTAGATTATCATCTTTACCAAGT
GCAAGTTCCGACAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 69977. Forward Primer - name:069977_F_cDNA_Plxna4, sequence:AGATCTTCTCCTATGTGGGCAA; Reverse Primer - name:069977_N_SP6_cDNA_Plxna4, sequence:CTGTCGGAACTTGCACTTGGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8535 same embryo
 EMAGE:8532 same embryo
 EMAGE:8533 same embryo
 EMAGE:8530 same embryo
 EMAGE:8531 same embryo
 EurExpress:euxassay_009720 same experiment
 MGI:4827292 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS