Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8548

Cbln2 cerebellin 2 precursor protein ( MGI:88282)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8548 EMAGE:8548 EMAGE:8548 EMAGE:8548 EMAGE:8548
"Pseudo-wholemount" of euxassay_009791. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009791_01 euxassay_009791_02 euxassay_009791_03 euxassay_009791_04
EMAGE:8548 EMAGE:8548 EMAGE:8548 EMAGE:8548 EMAGE:8548
euxassay_009791_05 euxassay_009791_06 euxassay_009791_07 euxassay_009791_08 euxassay_009791_09
EMAGE:8548 EMAGE:8548 EMAGE:8548 EMAGE:8548 EMAGE:8548
euxassay_009791_10 euxassay_009791_11 euxassay_009791_12 euxassay_009791_13 euxassay_009791_14
EMAGE:8548 EMAGE:8548 EMAGE:8548 EMAGE:8548 EMAGE:8548
euxassay_009791_15 euxassay_009791_16 euxassay_009791_17 euxassay_009791_18 euxassay_009791_19
EMAGE:8548 EMAGE:8548 EMAGE:8548 EMAGE:8548 EMAGE:8548
euxassay_009791_20 euxassay_009791_21 euxassay_009791_22 euxassay_009791_23 euxassay_009791_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8548Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8548_wholemount_strong.wlz
8548_wholemount_moderate.wlz
8548_wholemount_weak.wlz
8548_wholemount_possible.wlz
8548_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8548_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 04 05 06 07
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 19 20 21 23 24 weak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
organ system
moderate moderate
regionalmoderate expression: see section 22
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 weak expression: see section 01
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 14 15 16 17
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 15 16 17 18 19 20 21
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
glossopharyngeal ix ganglion
weak weak
spottedweak expression: see section 18
trigeminal v ganglion
moderate moderate
spottedmoderate expression: see section 19 20 21 weak expression: see section 03 04 05 06 07 18
vagus x ganglion
weak weak
spottedweak expression: see section 18
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 13 14 15 weak expression: see section 09 10
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 10 11 12
dorsal root ganglion
moderate moderate
spottedmoderate expression: see section 07 08 09 10 13 14 15 16 17 18
midgut
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30657
Entity Detected:Cbln2, cerebellin 2 precursor protein ( MGI:88282)
Sequence:sense strand is shown

>T30657
CAGCTTCCACGTGGTCAAAGTGTACAACAGACAAACTATCCAGGTCAGCTTAATGCAGAATGGCTACCCG
GTGATCTCTGCATTTGCCGGAGACCAGGATGTTACCAGGGAAGCAGCCAGCAATGGTGTTCTGCTGCTCA
TGGAAAGAGAAGACAAAGTTCATCTCAAACTAGAGAGAGGCAACCTCATGGGAGGCTGGAAATACTCCAC
ATTCTCGGGCTTCTTGGTTTTTCCTCTATAGACTCAGAGCCACCAGGATGATGGGAAGGTTTTGATCAGG
ACCCAGGGATCTGCCCCCTGTAACACCTTGAACTTGTCTGGATAGGATGGCTTGGGCCCACCTCCATCAG
ATTATTGCTGTAGAAGAATGACTTTCTTCTAAAGCTCCAGTATTTTCTTTGACTATTGACAATTCCTCGG
GAACCTGGCCTCTAATTAGTTTAAGAAGACAAGGTCTTAAGGAGAAATGAAATTATCGATTTGAGCAATT
TGTACCCGTGATTGTAAAGTCGATATCGGATTTTATTGTTGGAACCATTGGCTTAACTTCTCATGTTTGT
ACGGTGTATCTTGTCCTGATGACATAGATGCTGCTGACCCTCAGATGGATTGCACGCTTCAGTCAGGGCT
TAAAGCAAGAGCCCAGCAGAGGACCACCTAACCAGACAGTCTTTGACCTGTGTTCTGTGTGTGTGTAGCC
TTAAGAAAAAGAATGGCTTCATTTTCATTCCGTAGCTTTTCCCTAGGGTCTTGGGGGTCTTGGGAGGGAG
CTGGGCATTGGTAACCTGTCGAAAAGTGCTTTATCCTGAGAAGCAAATTTTGCACGATTGGACTGCAGTT
TCTGTTTTGTACCGTCTGTGATTTTCTTTTTTCCTCGGGAAGCTTTCCTTTTCTTCCTCAGGTTTCACTC
CTCAAACCTACTTAGTTTTCATGCTGGGGGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6412317), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59453. Forward Primer - name:059453_F_IRAV116_h09_Cbln2, sequence:CAGCTTCCACGTGGTCAA; Reverse Primer - name:059453_R_SP6_IRAV116_h09_Cbln2, sequence:AGCCCCCAGCATGAAAAC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8547 same embryo
 EMAGE:8546 same embryo
 EMAGE:8545 same embryo
 EMAGE:8550 same embryo
 EMAGE:8549 same embryo
 EurExpress:euxassay_009791 same experiment
 MGI:4823654 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS