Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8558

Nrxn3 neurexin III ( MGI:1096389)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8558 EMAGE:8558 EMAGE:8558 EMAGE:8558 EMAGE:8558
"Pseudo-wholemount" of euxassay_009777. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009777_01 euxassay_009777_02 euxassay_009777_03 euxassay_009777_04
EMAGE:8558 EMAGE:8558 EMAGE:8558 EMAGE:8558 EMAGE:8558
euxassay_009777_05 euxassay_009777_06 euxassay_009777_07 euxassay_009777_08 euxassay_009777_09
EMAGE:8558 EMAGE:8558 EMAGE:8558 EMAGE:8558 EMAGE:8558
euxassay_009777_10 euxassay_009777_11 euxassay_009777_12 euxassay_009777_13 euxassay_009777_14
EMAGE:8558 EMAGE:8558 EMAGE:8558 EMAGE:8558 EMAGE:8558
euxassay_009777_15 euxassay_009777_16 euxassay_009777_17 euxassay_009777_18 euxassay_009777_19
EMAGE:8558 EMAGE:8558 EMAGE:8558 EMAGE:8558 EMAGE:8558
euxassay_009777_20 euxassay_009777_21 euxassay_009777_22 euxassay_009777_23 euxassay_009777_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8558Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8558_wholemount_strong.wlz
8558_wholemount_moderate.wlz
8558_wholemount_weak.wlz
8558_wholemount_possible.wlz
8558_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8558_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vibrissa
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 18 19 20 21
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
cerebral cortex mantle layer
strong strong
single cellstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
telencephalon mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 12 13 14 15 16 17 18 19 20 21
medulla oblongata alar plate marginal layer
strong strong
regionalstrong expression: see section 11
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
pons mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21
spinal cord mantle layer
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18
inner ear
strong strong
regionalstrong expression: see section 03 04 05 21 22 23 24 moderate expression: see section 06 07 08 09
neural retina
strong strong
single cellstrong expression: see section 01 02 03 22 23
bladder
moderate moderate
regionalmoderate expression: see section 11 12 13
collecting duct
strong strong
regionalstrong expression: see section 09 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30626
Entity Detected:Nrxn3, neurexin III ( MGI:1096389)
Sequence:sense strand is shown

>T30626
ATGCAGGGCAGAAGCTCAATGACAATGAGTGGCACACCGTCCGGGTAGTGCGGAGAGGAAAAAGCCTTAA
GCTAACAGTGGATGATGATGTGGCTGAGGGGACAATGGTGGGCGACCACACCCGCCTGGAATTCCACAAT
ATTGAAACTGGTATCATGACTGAGAAGCGTTACATCTCTGTGGTCCCCTCCAGTTTCATTGGCCATCTAC
AGAGCCTCATGTTCAATGGCTTACTGTACATTGATTTGTGCAAAAATGGCGACATCGACTACTGTGAACT
GAAGGCTCGCTTTGGACTGAGAAACATCATCGCCGACCCTGTCACTTTTAAGACCAAGAGCAGCTACCTG
ACCCTCGCCACCCTACAGGCTTACACCTCCATGCACCTCTTCTTCCAGTTCAAGACCACTTCAGCTGATG
GCTTCATTCTCTTCAATAGCGGAGATGGCAATGATTTTATTGCAGTTGAGCTGGTCAAGGGGTACATACA
CTATGTGTTTGATCTCGGCAATGGTCCCAATGTGATCAAAGGCAACAGTGACCGCCCCCTGAATGACAAC
CAGTGGCACAACGTGGTCATCACCAGGGACAGCAGTAACACCCACAGTCTGAAGGTGGACACCAAGGTAG
TCACTCAGGTCATCAATGGTGCCAAAAATCTGGATTTGAAAGGTGACCTCTATATGGCTGGCTTAGCCCA
GGGCATGTACAGCAACCTTCCCAAGCTTGTGGCCTCCAGGGATGGATTTCAGGGCTGCCTGGCCTCTGTG
GACTTGAATGGACGCCTGCCTGATCTCATCAACGATGCTCTCCACAGGAGTGGACAGATCGAGCGAGGCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6406001), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59938. Forward Primer - name:059938_F_IRAV115_f01_Nrxn3, sequence:ATGCAGGGCAGAAGCTCA; Reverse Primer - name:059938_R_SP6_IRAV115_f01_Nrxn3, sequence:CAGCCTCGCTCGATCTGT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8557 same embryo
 EMAGE:8556 same embryo
 EMAGE:8554 same embryo
 EMAGE:8555 same embryo
 EurExpress:euxassay_009777 same experiment
 MGI:4826801 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS