Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8786

Pafah1b1 platelet-activating factor acetylhydrolase, isoform 1b, subunit 1 ( MGI:109520)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8786 EMAGE:8786 EMAGE:8786 EMAGE:8786 EMAGE:8786
"Pseudo-wholemount" of euxassay_009980. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009980_01 euxassay_009980_02 euxassay_009980_03 euxassay_009980_04
EMAGE:8786 EMAGE:8786 EMAGE:8786 EMAGE:8786 EMAGE:8786
euxassay_009980_05 euxassay_009980_06 euxassay_009980_07 euxassay_009980_08 euxassay_009980_09
EMAGE:8786 EMAGE:8786 EMAGE:8786 EMAGE:8786 EMAGE:8786
euxassay_009980_10 euxassay_009980_11 euxassay_009980_12 euxassay_009980_13 euxassay_009980_14
EMAGE:8786 EMAGE:8786 EMAGE:8786 EMAGE:8786 EMAGE:8786
euxassay_009980_15 euxassay_009980_16 euxassay_009980_17 euxassay_009980_18 euxassay_009980_19
EMAGE:8786 EMAGE:8786 EMAGE:8786
euxassay_009980_20 euxassay_009980_21 euxassay_009980_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8786Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8786_wholemount_strong.wlz
8786_wholemount_moderate.wlz
8786_wholemount_weak.wlz
8786_wholemount_possible.wlz
8786_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8786_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 17 18 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 08 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 15 16 17 18 19 20 21
vagus x ganglion
strong strong
regionalstrong expression: see section 08 16
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 07 08 16 17 18
trigeminal v nerve
strong strong
regionalstrong expression: see section 13 14
spinal cord
strong strong
regionalstrong expression: see section 10 11 12 13 14 15
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 14
cervical ganglion
strong strong
regionalstrong expression: see section 08 15
thoracic ganglion
strong strong
regionalstrong expression: see section 13 moderate expression: see section 10 12
dorsal root ganglion
strong strong
regionalstrong expression: see section 08 09 10 11 14 15 16 17
neural retina
strong strong
regionalstrong expression: see section 01 02 19 20 21 22
pharynx skeleton
strong strong
spottedstrong expression: see section 09
tongue
strong strong
spottedstrong expression: see section 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31149
Entity Detected:Pafah1b1, platelet-activating factor acetylhydrolase, isoform 1b, subunit 1 ( MGI:109520)
Sequence:sense strand is shown

>T31149
TCAGAAACGGGACCCAAAAGAATGGATTCCCCGTCCACCTGAGAAATACGCATTGAGTGGTCATAGGAGT
CCAGTTACTCGAGTCATTTTCCATCCTGTGTTCAGTGTTATGGTCTCTGCTTCAGAGGATGCTACAATTA
AGGTGTGGGATTATGAGACTGGAGATTTTGAGCGAACTCTCAAGGGCCATACAGACTCTGTACAGGACAT
TTCCTTTGACCACAGTGGCAAGCTTCTGGCTTCCTGTTCAGCAGATATGACGATTAAATTATGGGATTTT
CAGGGTTTTGAATGCATCAGAACCATGCACGGTCACGATCACAATGTCTCTTCAGTAGCCATCATGCCTA
ATGGAGATCATATAGTGTCTGCCTCAAGGGATAAAACTATAAAGATGTGGGAAGTGCAAACTGGCTACTG
TGTGAAGACATTCACAGGACACAGAGAATGGGTACGTATGGTGCGGCCAAATCAGGATGGCACTCTGATA
GCCAGCTGTTCCAATGACCAGACTGTGCGTGTGTGGGTTGTAGCAACAAAGGAATGCAAGGCTGAGCTCC
GAGAACATGAACATGTGGTGGAATGCATTTCCTGGGCTCCAGAAAGTTCATATTCTTCCATCTCTGAAGC
AACAGGATCTGAGACTAAAAAAAGTGGCAAGCCTGGACCTTTCTTGCTATCTGGTTCCAGAGACAAAACT
ATTAAGATGTGGGACGTCAGTACTGGCATGTGCCTTATGACTCTTGTGGGTCATGATAACTGGGTACGTG
GAGTTCTGTTCCATTCTGGGGGGAAGTTTATTTTGAGTTGTGCTGATGACAAGACCCTCCGTGTATGGGA
TTATAAGAACAAGCGATGCATGAAGACCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4017963), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 53333. Forward Primer - name:053333_F_IRAV44_f07_Pafah1b1, sequence:TCAGAAACGGGACCCAAA; Reverse Primer - name:053333_R_SP6_IRAV44_f07_Pafah1b1, sequence:AGGGTCTTCATGCATCGC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8785 same embryo
 EurExpress:euxassay_009980 same experiment
 MGI:4827025 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS