Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8790

Trak1 trafficking protein, kinesin binding 1 ( MGI:1914345)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8790 EMAGE:8790 EMAGE:8790 EMAGE:8790 EMAGE:8790
"Pseudo-wholemount" of euxassay_009992. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009992_01 euxassay_009992_02 euxassay_009992_03 euxassay_009992_04
EMAGE:8790 EMAGE:8790 EMAGE:8790 EMAGE:8790 EMAGE:8790
euxassay_009992_05 euxassay_009992_06 euxassay_009992_07 euxassay_009992_08 euxassay_009992_09
EMAGE:8790 EMAGE:8790 EMAGE:8790 EMAGE:8790 EMAGE:8790
euxassay_009992_10 euxassay_009992_11 euxassay_009992_12 euxassay_009992_13 euxassay_009992_14
EMAGE:8790 EMAGE:8790 EMAGE:8790 EMAGE:8790 EMAGE:8790
euxassay_009992_15 euxassay_009992_16 euxassay_009992_17 euxassay_009992_18 euxassay_009992_19
EMAGE:8790 EMAGE:8790 EMAGE:8790 EMAGE:8790 EMAGE:8790
euxassay_009992_20 euxassay_009992_21 euxassay_009992_22 euxassay_009992_23 euxassay_009992_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8790Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8790_wholemount_strong.wlz
8790_wholemount_moderate.wlz
8790_wholemount_weak.wlz
8790_wholemount_possible.wlz
8790_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8790_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 07 09 10 21
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 11 12 13 14 15
cerebral cortex mantle layer
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata basal plate ventricular layer
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15
pons ventricular layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17
midbrain ventricular layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15
facial vii ganglion
weak weak
regionalweak expression: see section 05 06 21
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 19
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 09 18 19 20 21 22 23
vagus x ganglion
weak weak
regionalweak expression: see section 08 18 19
spinal cord ventricular layer
weak weak
regionalweak expression: see section 12 13 14
dorsal root ganglion
weak weak
regionalweak expression: see section 09 10 11 13 14 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31739
Entity Detected:Trak1, trafficking protein, kinesin binding 1 ( MGI:1914345)
Sequence:sense strand is shown

>T31739
TGTGCAACAGCACCAACCTTCCAGAAGTTGAGATCATTAGCCTGCTGGAGGAACAGCTGCCCCATTACAA
GCTAAGAGCGGACACCATCTATGGTTACGACCACGATGACTGGCTGCATACGCCCCTCATCTCCCCAGAT
GCCAACATCGACCTCACAACTGAGCAGATCGAAGAGACGCTGAAATACTTCCTTCTATGTGCCGAAAGAG
TTGGCCAGATGACTAAAACATACAATGACATTGATGCTGTCACGAGGCTTCTTGAGGAGAAAGAGCGGGA
TTTGGAGCTGGCTGCGAGGATCGGTCAGTCATTGTTGAAGAAGAACAAGACCCTAACTGAGAGGAATGAA
CTGCTGGAAGAGCAGGTGGAGCACATCCGGGAGGAGGTGTCTCAGCTCCGACATGAGCTGTCCATGAAAG
ACGAGCTGCTTCAATTCTACACCAGTGCCGCTGAGGAGAGCGAGCCTGAGTCCGTCTGCTCAACCCCGCT
GAAGAGGAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6439375), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58221. Forward Primer - name:058221_F_IRAV91_f01_2310001H13Rik, sequence:TGTGCAACAGCACCAACC; Reverse Primer - name:058221_R_SP6_IRAV91_f01_2310001H13Rik, sequence:GTTCCTCTTCAGCGGGGT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8791 same embryo
 EMAGE:8789 same embryo
 EMAGE:8788 same embryo
 EMAGE:8792 same embryo
 EMAGE:8787 same embryo
 EurExpress:euxassay_009992 same experiment
 MGI:4828890 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS