Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8814

Ptp4a1 protein tyrosine phosphatase 4a1 ( MGI:1277096)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8814 EMAGE:8814 EMAGE:8814 EMAGE:8814 EMAGE:8814
"Pseudo-wholemount" of euxassay_010021. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010021_01 euxassay_010021_02 euxassay_010021_03 euxassay_010021_04
EMAGE:8814 EMAGE:8814 EMAGE:8814 EMAGE:8814 EMAGE:8814
euxassay_010021_05 euxassay_010021_06 euxassay_010021_07 euxassay_010021_08 euxassay_010021_09
EMAGE:8814 EMAGE:8814 EMAGE:8814 EMAGE:8814 EMAGE:8814
euxassay_010021_10 euxassay_010021_11 euxassay_010021_12 euxassay_010021_13 euxassay_010021_14
EMAGE:8814 EMAGE:8814 EMAGE:8814 EMAGE:8814 EMAGE:8814
euxassay_010021_15 euxassay_010021_16 euxassay_010021_17 euxassay_010021_18 euxassay_010021_19
EMAGE:8814 EMAGE:8814 EMAGE:8814 EMAGE:8814 EMAGE:8814
euxassay_010021_20 euxassay_010021_21 euxassay_010021_22 euxassay_010021_23 euxassay_010021_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8814Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8814_wholemount_strong.wlz
8814_wholemount_moderate.wlz
8814_wholemount_weak.wlz
8814_wholemount_possible.wlz
8814_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8814_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal gland
moderate moderate
regionalmoderate expression: see section 06 07 weak expression: see section 05 14 15
submandibular gland primordium
weak weak
regionalweak expression: see section 07 08 09 18 19
forebrain
moderate moderate
regionalmoderate expression: see section 21 22 23 24 weak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
hindbrain
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
spinal cord
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 08 15
cervical ganglion
weak weak
regionalweak expression: see section 08 16
thoracic ganglion
weak weak
regionalweak expression: see section 10 11
neural retina
weak weak
regionalweak expression: see section 02 03 04 23 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 16 weak expression: see section 09 14 15 17 18
stomach
moderate moderate
regionalmoderate expression: see section 05 06 07 08 weak expression: see section 09
lower jaw incisor
weak weak
regionalweak expression: see section 11 12 15 16
upper jaw incisor
weak weak
regionalweak expression: see section 11 12 15 16
bladder
weak weak
regionalweak expression: see section 11 12 13 14
lung
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31760
Entity Detected:Ptp4a1, protein tyrosine phosphatase 4a1 ( MGI:1277096)
Sequence:sense strand is shown

>T31760
TCCAACCAATGCGACCTTAAACAAATTTATAGAGGAACTTAAGAAGTATGGAGTTACCACAATAGTAAGA
GTATGTGAAGCAACTTACGACACTACTCTTGTGGAGAAAGAAGGCATTCATGTTCTTGACTGGCCTTTTG
ATGATGGTGCACCACCATCCAACCAGATTGTCGATGACTGGCTAAGTCTTGTGAAGATTAAGTTTCGTGA
AGAACCTGGTTGCTGTATTGCTGTCCATTGTGTCGCAGGCCTTGGCAGAGCTCCGGTGCTTGTTGCCCTA
GCATTAATTGAAGGTGGAATGAAATATGAAGATGCAGTACAATTCATAAGACAAAAGCGGCGTGGAGCTT
TTAACAGCAAGCAACTTTTGTATCTGGAGAAGTACCGTCCGAAAATGCGGCTCCGCTTCAAGGATTCCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6396041), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60678. Forward Primer - name:060678_F_IRAV95_a11_Ptp4a1, sequence:TCCAACCAATGCGACCTT; Reverse Primer - name:060678_R_SP6_IRAV95_a11_Ptp4a1, sequence:TTGGAATCCTTGAAGCGG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8812 same embryo
 EMAGE:8811 same embryo
 EMAGE:8813 same embryo
 EMAGE:8810 same embryo
 EurExpress:euxassay_010021 same experiment
 MGI:4827513 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS