Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8921

Gzmn granzyme N ( MGI:2675494)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8921 EMAGE:8921 EMAGE:8921 EMAGE:8921 EMAGE:8921
"Pseudo-wholemount" of euxassay_012855. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012855_01 euxassay_012855_02 euxassay_012855_03 euxassay_012855_04
EMAGE:8921 EMAGE:8921 EMAGE:8921 EMAGE:8921 EMAGE:8921
euxassay_012855_05 euxassay_012855_06 euxassay_012855_07 euxassay_012855_08 euxassay_012855_09
EMAGE:8921 EMAGE:8921 EMAGE:8921 EMAGE:8921 EMAGE:8921
euxassay_012855_10 euxassay_012855_11 euxassay_012855_12 euxassay_012855_13 euxassay_012855_14
EMAGE:8921 EMAGE:8921 EMAGE:8921 EMAGE:8921 EMAGE:8921
euxassay_012855_15 euxassay_012855_16 euxassay_012855_17 euxassay_012855_18 euxassay_012855_19
EMAGE:8921 EMAGE:8921 EMAGE:8921 EMAGE:8921
euxassay_012855_20 euxassay_012855_21 euxassay_012855_22 euxassay_012855_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8921Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8921_wholemount_strong.wlz
8921_wholemount_moderate.wlz
8921_wholemount_weak.wlz
8921_wholemount_possible.wlz
8921_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8921_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
single cellmoderate expression: see section 06 07 08 09 10 12 13 14 15 16
cerebral cortex marginal layer
moderate moderate
regionalmoderate expression: see section 02 03 05 06 07 17 18 19 20 21 22 weak expression: see section 01 08 09 10 11 12 14 15 16
medulla oblongata alar plate mantle layer
moderate moderate
single cellmoderate expression: see section 07 11 12 13 14 15
medulla oblongata basal plate mantle layer
moderate moderate
single cellmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15
rest of cerebellum mantle layer
moderate moderate
single cellmoderate expression: see section 03 04 05 06 07 10 11 12 13 14 15 16
pons mantle layer
moderate moderate
single cellmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16
midbrain mantle layer
moderate moderate
single cellmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16
facial vii ganglion
weak weak
regionalweak expression: see section 03 04 17 18
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 04 14 15 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 02 03 04 05 06 07 15 16 17 18 20
vagus x ganglion
weak weak
regionalweak expression: see section 05 14
ventral grey horn
moderate moderate
regionalmoderate expression: see section 06 08 12 weak expression: see section 07 09 10 11
dorsal root ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 12 13 14 15
neural retina
weak weak
regionalweak expression: see section 01 02 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38506
Entity Detected:Gzmn, granzyme N ( MGI:2675494)
Sequence:sense strand is shown

>T38506
CAAGACTACTTTGTGCTGACGGCTGCTCACTGCATTGGAAGCTCAATGACAGTCACACTGGGGGCCCACA
ACCTCCGTGCACAGGAGGAGACTCAGCAGATTATTCCTGTGAATAAAGCTCTTCCCCACCCAGACTATAA
TCCTCTGGATCACACCAATGACATCATGCTATTAAAGCTGGAGAGTAAGGCCAAGGGGACTAGAGATGTG
AGGCCCCTCAAGTTGCCTGGGCCCAAAGACAAGGTGAATCCAGGGGATGTGTGCAGTGTGGCTGGCTGGG
GGAAAACGTCCATCAATACCACTGAAGGATCTGCTCTCTTAGAAGAGGCTGAATTGATCATCCAGGAGAA
CAAGGAATGCAAAAAACAATTCCGTCACTATTCCAAAATCACAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 150146. Forward Primer - name:150146_F_cDNA_Gzmn, sequence:CAAGACTACTTTGTGCTGACGG; Reverse Primer - name:150146_N_SP6_cDNA_Gzmn, sequence:CTGTGATTTTGGAATAGTGACGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8923 same embryo
 EMAGE:8920 same embryo
 EMAGE:8924 same embryo
 EMAGE:8919 same embryo
 EMAGE:8922 same embryo
 EurExpress:euxassay_012855 same experiment
 MGI:4825296 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS