Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9289

Ckmt1 creatine kinase, mitochondrial 1, ubiquitous ( MGI:99441)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9289 EMAGE:9289 EMAGE:9289 EMAGE:9289 EMAGE:9289
"Pseudo-wholemount" of euxassay_018134. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018134_01 euxassay_018134_02 euxassay_018134_03 euxassay_018134_04
EMAGE:9289 EMAGE:9289 EMAGE:9289 EMAGE:9289 EMAGE:9289
euxassay_018134_05 euxassay_018134_06 euxassay_018134_07 euxassay_018134_08 euxassay_018134_09
EMAGE:9289 EMAGE:9289 EMAGE:9289 EMAGE:9289 EMAGE:9289
euxassay_018134_10 euxassay_018134_11 euxassay_018134_12 euxassay_018134_13 euxassay_018134_14
EMAGE:9289 EMAGE:9289 EMAGE:9289 EMAGE:9289 EMAGE:9289
euxassay_018134_15 euxassay_018134_16 euxassay_018134_17 euxassay_018134_18 euxassay_018134_19
EMAGE:9289 EMAGE:9289 EMAGE:9289 EMAGE:9289 EMAGE:9289
euxassay_018134_20 euxassay_018134_21 euxassay_018134_22 euxassay_018134_23 euxassay_018134_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9289Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9289_wholemount_strong.wlz
9289_wholemount_moderate.wlz
9289_wholemount_weak.wlz
9289_wholemount_possible.wlz
9289_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9289_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50259
Entity Detected:Ckmt1, creatine kinase, mitochondrial 1, ubiquitous ( MGI:99441)
Sequence:sense strand is shown

>T50259
AGTCAGAGGTGGAGCTGGTGCAGCTCGTCATCGATGGGGTGAACTATTTGATTGACTGTGAACGGCGTCT
GGAGAGAGGACAGGATATTCGAATCCCTCCACCTCTTGTCCACAGCAAACATTAACTCCCCATCCCCAGC
GGATGAGTCAAGACCCCCAGGACTTCTGCATATTTAACAGTGGCCCAGTCTACTTGCCCTGGACC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:AGTCAGAGGTGGAGCTGGTG; Reverse Primer - name:unspecified, sequence:GTCCAGGGCAAGTAGACTG. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9290 same embryo
 EMAGE:9291 same embryo
 EMAGE:9288 same embryo
 EMAGE:9287 same embryo
 EMAGE:9292 same embryo
 EurExpress:euxassay_018134 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS