Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10012

Samd14 sterile alpha motif domain containing 14 ( MGI:2384945)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10012 EMAGE:10012 EMAGE:10012 EMAGE:10012 EMAGE:10012
"Pseudo-wholemount" of euxassay_008154. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008154_01 euxassay_008154_02 euxassay_008154_03 euxassay_008154_04
EMAGE:10012 EMAGE:10012 EMAGE:10012 EMAGE:10012 EMAGE:10012
euxassay_008154_05 euxassay_008154_06 euxassay_008154_07 euxassay_008154_08 euxassay_008154_09
EMAGE:10012 EMAGE:10012 EMAGE:10012 EMAGE:10012 EMAGE:10012
euxassay_008154_10 euxassay_008154_11 euxassay_008154_12 euxassay_008154_13 euxassay_008154_14
EMAGE:10012 EMAGE:10012 EMAGE:10012 EMAGE:10012 EMAGE:10012
euxassay_008154_15 euxassay_008154_16 euxassay_008154_17 euxassay_008154_18 euxassay_008154_19
EMAGE:10012 EMAGE:10012 EMAGE:10012 EMAGE:10012 EMAGE:10012
euxassay_008154_20 euxassay_008154_21 euxassay_008154_22 euxassay_008154_23 euxassay_008154_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10012Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10012_wholemount_strong.wlz
10012_wholemount_moderate.wlz
10012_wholemount_weak.wlz
10012_wholemount_possible.wlz
10012_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10012_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 23 24
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 09 21 weak expression: see section 08
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 19 20 21 22 23 24
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 10 20
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 10 11 13 14 18 19 21 weak expression: see section 12 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T108
Entity Detected:Samd14, sterile alpha motif domain containing 14 ( MGI:2384945)
Sequence:sense strand is shown

>T108
CTGAAGGCCAGGGCCCTATGTTTGTGCTCAGTCACCTTCACTGGAAGAGGGGGCCTCATAGGGAAAACTA
AGGTATCGGGGCACTGGCACTTCCTAGACTGGGTGGGGAGGGTGGAGGCTCTACTGTCCCCGAAGCCGTG
AAGAGCCAAGTGTGCCCACCTGCATGTGAAGGGGGAAGATGGCTATCAACTTCTTTCAATAAATACTTAC
CACACAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:600457 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:600457 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4827862 same experiment
 EurExpress:euxassay_008154 same experiment
 EMAGE:31547 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS