Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10062

6430598A04Rik RIKEN cDNA 6430598A04 gene ( MGI:2443880)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10062 EMAGE:10062 EMAGE:10062 EMAGE:10062 EMAGE:10062
"Pseudo-wholemount" of euxassay_000107. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000107_01 euxassay_000107_02 euxassay_000107_03 euxassay_000107_04
EMAGE:10062 EMAGE:10062 EMAGE:10062 EMAGE:10062 EMAGE:10062
euxassay_000107_05 euxassay_000107_06 euxassay_000107_07 euxassay_000107_08 euxassay_000107_09
EMAGE:10062 EMAGE:10062 EMAGE:10062 EMAGE:10062 EMAGE:10062
euxassay_000107_10 euxassay_000107_11 euxassay_000107_12 euxassay_000107_13 euxassay_000107_14
EMAGE:10062 EMAGE:10062 EMAGE:10062 EMAGE:10062 EMAGE:10062
euxassay_000107_15 euxassay_000107_16 euxassay_000107_17 euxassay_000107_18 euxassay_000107_19
EMAGE:10062 EMAGE:10062 EMAGE:10062 EMAGE:10062 EMAGE:10062
euxassay_000107_20 euxassay_000107_21 euxassay_000107_22 euxassay_000107_23 euxassay_000107_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10062Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10062_wholemount_strong.wlz
10062_wholemount_moderate.wlz
10062_wholemount_weak.wlz
10062_wholemount_possible.wlz
10062_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10062_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
central nervous system
strong strong
homogeneousstrong expression: see section 08 moderate expression: see section 09
brain
moderate moderate
homogeneousmoderate expression: see section 09 10 11
diencephalon
strong strong
regionalstrong expression: see section 12 16 moderate expression: see section 14
telencephalon
moderate moderate
homogeneousmoderate expression: see section 12 not examined expression: see section 14
cerebral cortex
strong strong
regionalstrong expression: see section 01 23 not examined expression: see section 14
cerebral cortex marginal layer
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
corpus striatum
moderate moderate
regionalmoderate expression: see section 23 24
telencephalon marginal layer
strong strong
homogeneousstrong expression: see section 16 18 20 21 22
olfactory cortex marginal layer
strong strong
homogeneousstrong expression: see section 12 13 14 15 16 18 19 20 21 22
hindbrain
strong strong
homogeneousstrong expression: see section 13 moderate expression: see section 12 17
metencephalon lateral wall
moderate moderate
homogeneousmoderate expression: see section 22
metencephalon alar plate
moderate moderate
regionalmoderate expression: see section 18
cerebellum
strong strong
regionalstrong expression: see section 13 16 moderate expression: see section 14 20 21 22 weak expression: see section 15
rest of cerebellum
moderate moderate
regionalmoderate expression: see section 21
metencephalon rest of alar plate
moderate moderate
regionalmoderate expression: see section 23
metencephalon basal plate
strong strong
regionalstrong expression: see section 13 moderate expression: see section 18 20 21 22
metencephalon sulcus limitans
strong strong
regionalstrong expression: see section 16 moderate expression: see section 20
midbrain
strong strong
homogeneousstrong expression: see section 12
midbrain lateral wall
moderate moderate
homogeneousmoderate expression: see section 22 not examined expression: see section 13
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 21 22
midbrain marginal layer
strong strong
homogeneousstrong expression: see section 11 12 13 14 15 16 17 18 19 20 moderate expression: see section 10 21 22
tegmentum
strong strong
homogeneousstrong expression: see section 15 moderate expression: see section 21
facial vii ganglion
strong strong
homogeneousstrong expression: see section 09 10 moderate expression: see section 21
glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 08 10 moderate expression: see section 21
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 05 06 07 08 09 10 22 23 24 moderate expression: see section 11 12 21 weak expression: see section 20
vagus x ganglion
strong strong
homogeneousstrong expression: see section 09 10 22 moderate expression: see section 21 weak expression: see section 20
vestibulocochlear viii ganglion
strong strong
homogeneousstrong expression: see section 08 09 10 22 moderate expression: see section 21 weak expression: see section 20
spinal cord
moderate moderate
homogeneousmoderate expression: see section 14 15 16 17 18
spinal cord lateral wall
strong strong
homogeneousstrong expression: see section 17
spinal cord sulcus limitans
strong strong
homogeneousstrong expression: see section 17
spinal ganglion
moderate moderate
homogeneousmoderate expression: see section 12
dorsal root ganglion
strong strong
homogeneousstrong expression: see section 10 11 13 moderate expression: see section 12 14 15 19 20
neural retina
strong strong
homogeneousstrong expression: see section 02 03 04 05
retina nuclear layer
strong strong
homogeneousstrong expression: see section 02 03 04 05
nucleus pulposus
strong strong
regionalstrong expression: see section 16 moderate expression: see section 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1520
Entity Detected:6430598A04Rik, RIKEN cDNA 6430598A04 gene ( MGI:2443880)
Sequence:sense strand is shown

>T1520
AGTGGACAAAGAGGACGGTGCCCGAGCCTGGAATGGCAGTACAGAAGGTCCAGGCAAAGTCGAACATGAG
GACAGGGGCCCTGTGCCATCAGGGATTCCTGTGAGGAGCCAGGGGGCAGAGGGTCTGCTGGCCAGGATCC
ACCATGATCGAGGAGGGAGCCGCACAGCGCTGCCTGTCCCTTGCCAGACTTTCCCTGCCTGCCACCGGAA
TGGAGATTTCACGGGAGGGTACCGCCTGGGCCGTTCTGCGTCCACCTCTGGAGTCCGTCAGGCTGCACTC
CATACCCCACGGCCCTGCAGCCAGCCCAGGGATGCCCTGAGCCAGACACACCCTGTGCTGCCCCTGCCCC
TGCCGCCCCAGCCGGCTCGGGAGCGCGATGGCAAACTCCTAGAGGTGATCGAGCGCAAACGCTGCGTGTG
CAAGGAGATCAAGGCACGCCACCGTCCCGACCGGGGGCTCTGCAAGCAAGAGAGCATGCCCATCC
Notes:The probe template was PCR amplified from IMAGE:805332 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:805332 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10064 same embryo
 EMAGE:10063 same embryo
 EMAGE:10061 same embryo
 EMAGE:10060 same embryo
 EurExpress:euxassay_000107 same experiment
 MGI:4822784 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS