Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10064

Cse1l chromosome segregation 1-like (S. cerevisiae) ( MGI:1339951)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10064 EMAGE:10064 EMAGE:10064 EMAGE:10064 EMAGE:10064
"Pseudo-wholemount" of euxassay_000112. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000112_01 euxassay_000112_02 euxassay_000112_03 euxassay_000112_04
EMAGE:10064 EMAGE:10064 EMAGE:10064 EMAGE:10064 EMAGE:10064
euxassay_000112_05 euxassay_000112_06 euxassay_000112_07 euxassay_000112_08 euxassay_000112_09
EMAGE:10064 EMAGE:10064 EMAGE:10064 EMAGE:10064 EMAGE:10064
euxassay_000112_10 euxassay_000112_11 euxassay_000112_12 euxassay_000112_13 euxassay_000112_14
EMAGE:10064 EMAGE:10064 EMAGE:10064 EMAGE:10064 EMAGE:10064
euxassay_000112_15 euxassay_000112_16 euxassay_000112_17 euxassay_000112_18 euxassay_000112_19
EMAGE:10064 EMAGE:10064 EMAGE:10064 EMAGE:10064 EMAGE:10064
euxassay_000112_20 euxassay_000112_21 euxassay_000112_22 euxassay_000112_23 euxassay_000112_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10064Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10064_wholemount_strong.wlz
10064_wholemount_moderate.wlz
10064_wholemount_weak.wlz
10064_wholemount_possible.wlz
10064_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10064_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10
thymus primordium
strong strong
homogeneousstrong expression: see section 13 14 moderate expression: see section 16 17 18
oral region gland
moderate moderate
homogeneousmoderate expression: see section 12
submandibular gland primordium
strong strong
homogeneousstrong expression: see section 08 09 11 19 20 21 22 23 moderate expression: see section 12
physiological umbilical hernia
moderate moderate
regionalmoderate expression: see section 20
vibrissa
strong strong
regionalstrong expression: see section 08 23 24 moderate expression: see section 06 07 09 10 11
diencephalon lateral wall ventricular layer
strong strong
homogeneousstrong expression: see section 15
cerebral cortex ventricular layer
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 08 09 10 11 12 13 14 15 17 18 19 20 21 22 23 24
midbrain ventricular layer
strong strong
homogeneousstrong expression: see section 11 12 13 14 15 16 17
glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 09 10 weak expression: see section 06
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 09 10 weak expression: see section 06 07 08 20
vagus x ganglion
moderate moderate
homogeneousmoderate expression: see section 10 weak expression: see section 07
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
lower jaw incisor
strong strong
regionalstrong expression: see section 13 14 15 18 19
upper jaw incisor
strong strong
regionalstrong expression: see section 13 14 15 18 19 20
liver
strong strong
spottedstrong expression: see section 01 02 03 06 07 08 09 moderate expression: see section 10 13 14 17 18 23 24 weak expression: see section 11 12 15 16 20 21 22
metanephros
strong strong
regionalstrong expression: see section 09 10 11 12 23 moderate expression: see section 19 24
renal cortex
strong strong
homogeneousstrong expression: see section 20 22 23 moderate expression: see section 21
lung
strong strong
spottedstrong expression: see section 06 07 08 09 12 moderate expression: see section 10 11 13 14 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1534
Entity Detected:Cse1l, chromosome segregation 1-like (S. cerevisiae) ( MGI:1339951)
Sequence:sense strand is shown

>T1534
ACAAGAGTTTATCCCATATGTCTTTCAAGTGATGTCTTTACTTCTGGAAACACATAAAAATGATATCCCG
TCTTCCTATATGGCCTTGTTTCCCCACCTCCTTCAGCCAGTACTGTGGGAAAGGACAGGAAACATCCCTG
CTCTAGTGAGGCTGCTCCAGGCATTCTTAGAACGAGGCTCAAGTACAATAGCAACTGCTGCAGCTGACAA
AATTCCTGGATTACTGGGTGTCTTCCAGAAGCTGATTGCATCCAAGGCAAACGATCACCAAGGTTTCTAT
CTTCTCAACAGTATAATCGAACACATGCCTCCTGAATCAGTTGACCAGTATAGGAAGCAGATCTTCATTC
TACTATTCCAGAGACTGCAAAACTCCAAGACCACCAAGTTTATCAAGAGTTTCTTAGTGTTTATTAACTT
ATATTGCATTAAGTATGGGGCACTAGCATTACAAGAAATATTTGATGGCATACAACCAAAAATGTTTGGA
ATGGTTTTGGAAAAAATCATTATTCCAGA
Notes:The probe template was PCR amplified from IMAGE:821867 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:821867 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10062 same embryo
 EMAGE:10063 same embryo
 EMAGE:10061 same embryo
 EMAGE:10060 same embryo
 EurExpress:euxassay_000112 same experiment
 MGI:4824077 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS