Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10082

Lrrtm1 leucine rich repeat transmembrane neuronal 1 ( MGI:2389173)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10082 EMAGE:10082 EMAGE:10082 EMAGE:10082 EMAGE:10082
"Pseudo-wholemount" of euxassay_000022. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000022_01 euxassay_000022_02 euxassay_000022_03 euxassay_000022_04
EMAGE:10082 EMAGE:10082 EMAGE:10082 EMAGE:10082 EMAGE:10082
euxassay_000022_05 euxassay_000022_06 euxassay_000022_07 euxassay_000022_08 euxassay_000022_09
EMAGE:10082 EMAGE:10082 EMAGE:10082 EMAGE:10082 EMAGE:10082
euxassay_000022_10 euxassay_000022_11 euxassay_000022_12 euxassay_000022_13 euxassay_000022_14
EMAGE:10082 EMAGE:10082 EMAGE:10082 EMAGE:10082 EMAGE:10082
euxassay_000022_15 euxassay_000022_16 euxassay_000022_17 euxassay_000022_18 euxassay_000022_19
EMAGE:10082 EMAGE:10082 EMAGE:10082 EMAGE:10082
euxassay_000022_20 euxassay_000022_21 euxassay_000022_22 euxassay_000022_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10082Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10082_wholemount_strong.wlz
10082_wholemount_moderate.wlz
10082_wholemount_weak.wlz
10082_wholemount_possible.wlz
10082_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10082_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
tail vertebral pre-cartilage condensation
strong strong
regionalstrong expression: see section 13 15 16 17
interdigital region between forelimb digits 1 and 2 mesenchyme
moderate moderate
homogeneousmoderate expression: see section 22
foot
strong strong
regionalstrong expression: see section 02
hindlimb digit 2
strong strong
regionalstrong expression: see section 19
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 19
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 19
interdigital region between hindlimb digits 1 and 2 mesenchyme
strong strong
regionalstrong expression: see section 03 19 moderate expression: see section 20
interdigital region between hindlimb digits 2 and 3 mesenchyme
strong strong
regionalstrong expression: see section 03 04 19 moderate expression: see section 20
interdigital region between hindlimb digits 3 and 4 mesenchyme
strong strong
regionalstrong expression: see section 03 04 19 moderate expression: see section 20
interdigital region between hindlimb digits 4 and 5 mesenchyme
strong strong
regionalstrong expression: see section 03 04 19 moderate expression: see section 20
knee rest of mesenchyme
moderate moderate
homogeneousmoderate expression: see section 22
head mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 20 21 moderate expression: see section 19 not examined expression: see section 17
body-wall mesenchyme
strong strong
regionalstrong expression: see section 09 10 11 15 16 17
oral region
strong strong
regionalstrong expression: see section 06 07 16 17
3rd ventricle
strong strong
regionalstrong expression: see section 11
diencephalon lateral wall
moderate moderate
single cellmoderate expression: see section 09
diencephalon lateral wall mantle layer
strong strong
single cellstrong expression: see section 09 moderate expression: see section 05 06 07 08 10 11 13 15 16
cerebral cortex mantle layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 15 16 17 19 20 21 22 23
cerebral cortex marginal layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 15 16 17
lentiform nucleus
moderate moderate
regionalmoderate expression: see section 06 16
olfactory cortex mantle layer
moderate moderate
single cellmoderate expression: see section 08 09 10 11
olfactory cortex marginal layer
moderate moderate
single cellmoderate expression: see section 09 10 11
medulla oblongata alar plate mantle layer
moderate moderate
single cellmoderate expression: see section 05 06 07 08 09 10 11 13 16
medulla oblongata basal plate mantle layer
moderate moderate
single cellmoderate expression: see section 05 06 07 08 09 10 11 13 16
rest of cerebellum mantle layer
strong strong
single cellstrong expression: see section 02 03 04 17 19 20 moderate expression: see section 06 07 08 09 10 11 13 16
metencephalon rest of alar plate mantle layer
moderate moderate
single cellmoderate expression: see section 03 04 05 06 07 08 09 10 11 13 16 17
pons mantle layer
moderate moderate
single cellmoderate expression: see section 05 06 07 08 09 10 11 13 16
midbrain mantle layer
moderate moderate
single cellmoderate expression: see section 04 05 06 07 08 09 10 11 13 15
midbrain marginal layer
moderate moderate
single cellmoderate expression: see section 04
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 02 21 moderate expression: see section 01 03 04 05 06 07 16 17 weak expression: see section 19
vagus x ganglion
moderate moderate
homogeneousmoderate expression: see section 06
central nervous system nerve
strong strong
single cellstrong expression: see section 06
ventral grey horn
strong strong
single cellstrong expression: see section 08 09 10 11 13 15 16
spinal ganglion
strong strong
single cellstrong expression: see section 07
dorsal root ganglion
moderate moderate
homogeneousmoderate expression: see section 06 08 09 10 11 15 16 17
spinal nerve plexus
strong strong
single cellstrong expression: see section 10
sensory organ system
strong strong
regionalstrong expression: see section 11
otic capsule
strong strong
regionalstrong expression: see section 03
lower eyelid epithelium
strong strong
homogeneousstrong expression: see section 01
upper eyelid epithelium
strong strong
homogeneousstrong expression: see section 01
nasal capsule
strong strong
regionalstrong expression: see section 08 09 10 15
nasal septum mesenchyme
strong strong
regionalstrong expression: see section 11
naso-lacrimal duct
strong strong
homogeneousstrong expression: see section 22
pharynx
strong strong
regionalstrong expression: see section 10
pharynx
strong strong
regionalstrong expression: see section 08 09 13 16 moderate expression: see section 11 15 17
oral cavity
strong strong
regionalstrong expression: see section 04 05 08
metanephros
strong strong
regionalstrong expression: see section 03 04
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1709
Entity Detected:Lrrtm1, leucine rich repeat transmembrane neuronal 1 ( MGI:2389173)
Sequence:sense strand is shown

>T1709
TGGCCTCGAGCCAGATTCGGACGAGGCTCACGTGGCTGTATTTGGATCACAATCACATCTGCTCGGTGCA
GGGGGACGCCTTTCAGAAACTGCGCCGAGTTAAGGAACTCACGCTGAGTTCCAACCAGATCACTGAACTG
GCCAACACCACCTTCCGGCCCATGCCCAACCTGCGCAGCGTGGACCTGTCCTATAACAAGCTGCAGGCGC
TAGCTCCGGATCTCTTCCACGGGCTGCGGAAGCTCACCACCCTGCACATGCGGGCCAATGCCATCCAATT
CGTGCCGGTGCGCATCTTTCAGGACTGCCGCAGCCTCAAGTTTCTCGACATTGGATACAATCAGCTCAAG
AGTCTGGCGCGCAACTCTTTCGCCGGCTTGTTCAAGCTCACAGAGCTACACCTGGAGCATAATGACTTGA
TCAAGGTGAACTTCGCCCATTTCCCGCGCCTCATCTCCCTGCACTCGCTCTGCCTGAGGCGGAATAAGGT
TGCCATTGTGGTCAGCTCTCTCGACTGGGTTTGGAATTTGGAGAAAATGGACTTGTCTGGGAACGAGATC
Notes:The probe template was PCR amplified from IMAGE:478323 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:478323 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10081 same embryo
 EMAGE:10083 same embryo
 EurExpress:euxassay_000022 same experiment
 MGI:4826008 same experiment
 EMAGE:31406 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS