Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:1009

Acvr2b activin receptor IIB ( MGI:87912)
TS20 (12.5 dpc)
in situ hybridisation

Data Images
EMAGE:1009 EMAGE:1009
Fig 10F, Feijen et al, 1994 [PMID:7821227] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd who owns the copyright. Fig 10F, Feijen et al, 1994 [PMID:7821227] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd who owns the copyright.

Expression pattern clarity: two stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Corresponding bright and dark field images are shown. Image annotations: co, cochlea; cs, corpus striatum; di, diencephalon; e, eye; sc, spinal cord; se, semicircular canal; te, telencephalon; tg, trigeminal ganglion.
Expression Pattern Description
Spatial Annotation:
EMAGE:1009EMAGE:1009Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
1009_voxel_strong_3D_1.wlz
1009_voxel_moderate_3D_1.wlz
1009_voxel_possible_3D_1.wlz
1009_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:1009_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
detected detected
regionalExpressed in the mantle layer; also in the ependymal layer.
spinal cord
detected detected
regionalExpressed in the mantle layer; also in the ependymal layer.
diencephalon
detected detected
superior semicircular canal
detected detected
telencephalon
detected detected
posterior semicircular canal
detected detected
cochlear duct epithelium
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:23938
Entity Detected:Acvr2b, activin receptor IIB ( MGI:87912)
Sequence:sense strand is shown

>MGI:23938
GGCTGCTGGCTAGATGACTTCAATTGCTACGACAGGCAGGAGTGTGTGGCCACCGAGGAGAACCCCCAGG
TGTACTTCTGCTGCTGCGAAGGCAACTTCTGCAACGAGCGCTTCACCCACTTGCCGGAGCCTGGGGGCCC
AGAAGTCACGTACGAGCCACCCCCGACAGCCCCCACCCTGCTCACGGTGCTGGCCTACTCGCTGCTGCCC
ATTGGAGGCCTCTCTCTCATCGTCC
nt 269 - nt 503 of M84120.1
Notes:The probe used in this study by Feijen et al, 1994 [PMID:7821227] is described as: "activin type IIB receptor, a 235 nucleotide fragment, spanning amino acid residues 75-153 (Attisano et al., 1992 [PMID:1310075] )". The probe end points above (with reference to M84120.1) were deduced from this information.
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Strain:(C57BL/6 x CBA)F1
Age:12.5 dpc
Theiler Stage:TS20
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:paraffin
Staining procedure:autoradiography
General Information
Authors:Feijen et al, 1994 [PMID:7821227] Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:7821227] Feijen A, Goumans MJ, van den Eijnden-van Raaij AJ 1994 Expression of activin subunits, activin receptors and follistatin in postimplantation mouse embryos suggests specific developmental functions for different activins. Development (120):3621-37
 [ doi:10.1016/0092-8674(92)90209-U] [ PMID:1310075] Attisano L, Wrana JL, Cheifetz S, Massague J 1992 Novel activin receptors: distinct genes and alternative mRNA splicing generate a repertoire of serine/threonine kinase receptors. Cell (68):97-108
Links:MGI:2135923 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI