Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10116

Fam55b family with sequence similarity 55, member B ( MGI:1925502)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10116 EMAGE:10116 EMAGE:10116 EMAGE:10116 EMAGE:10116
"Pseudo-wholemount" of euxassay_000105. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000105_01 euxassay_000105_02 euxassay_000105_03 euxassay_000105_04
EMAGE:10116 EMAGE:10116 EMAGE:10116 EMAGE:10116 EMAGE:10116
euxassay_000105_05 euxassay_000105_06 euxassay_000105_07 euxassay_000105_08 euxassay_000105_09
EMAGE:10116 EMAGE:10116 EMAGE:10116 EMAGE:10116 EMAGE:10116
euxassay_000105_10 euxassay_000105_11 euxassay_000105_12 euxassay_000105_13 euxassay_000105_14
EMAGE:10116 EMAGE:10116 EMAGE:10116 EMAGE:10116 EMAGE:10116
euxassay_000105_15 euxassay_000105_16 euxassay_000105_17 euxassay_000105_18 euxassay_000105_19
EMAGE:10116 EMAGE:10116 EMAGE:10116 EMAGE:10116 EMAGE:10116
euxassay_000105_20 euxassay_000105_21 euxassay_000105_22 euxassay_000105_23 euxassay_000105_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10116Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10116_wholemount_strong.wlz
10116_wholemount_moderate.wlz
10116_wholemount_weak.wlz
10116_wholemount_possible.wlz
10116_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10116_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
forelimb
moderate moderate
regionalmoderate expression: see section 03 04
arm
moderate moderate
regionalmoderate expression: see section 02
shoulder
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 07 weak expression: see section 06
shoulder mesenchyme
moderate moderate
regionalmoderate expression: see section 02
leg
moderate moderate
regionalmoderate expression: see section 02 03 04
hip
moderate moderate
regionalmoderate expression: see section 02 07 weak expression: see section 06
upper leg
moderate moderate
regionalmoderate expression: see section 02 03 04
axial muscle
moderate moderate
regionalmoderate expression: see section 07 08 09 weak expression: see section 24
cranial muscle
strong strong
regionalstrong expression: see section 19 20 moderate expression: see section 07 09 23 weak expression: see section 16 18 22 24
pectoral girdle and thoracic body wall muscle
strong strong
regionalstrong expression: see section 19 20 moderate expression: see section 06 07 08 09 11 12 23 weak expression: see section 22 24
pelvic girdle muscle
strong strong
regionalstrong expression: see section 20 moderate expression: see section 07 08 16 23 weak expression: see section 17 18 22 24
gut
moderate moderate
regionalmoderate expression: see section 05 07 08 weak expression: see section 09
not examined not examined
othernot examined expression: see section 01
pituitary gland
weak weak
regionalweak expression: see section 16
neurohypophysis
moderate moderate
regionalmoderate expression: see section 14 15 weak expression: see section 11 12 13
vibrissa
weak weak
spottedweak expression: see section 04
trigeminal v ganglion
weak weak
homogeneousweak expression: see section 18 19 20 23
spinal ganglion
moderate moderate
homogeneousmoderate expression: see section 17
dorsal root ganglion
moderate moderate
homogeneousmoderate expression: see section 10 11 12 17 weak expression: see section 18
labyrinth
moderate moderate
regionalmoderate expression: see section 03 weak expression: see section 02 07
otic capsule
moderate moderate
regionalmoderate expression: see section 03 weak expression: see section 02
eye skeletal muscle
moderate moderate
regionalmoderate expression: see section 20
naso-lacrimal duct
moderate moderate
spottedmoderate expression: see section 04 weak expression: see section 03
viscerocranium
weak weak
spottedExpression in the turbinate bone.
heart
moderate moderate
regionalmoderate expression: see section 07 08 14 weak expression: see section 15
heart ventricle
moderate moderate
regionalmoderate expression: see section 07 08 14 18 weak expression: see section 10 15
stomach
moderate moderate
regionalmoderate expression: see section 02 03 05
liver
strong strong
homogeneousstrong expression: see section 10 moderate expression: see section 01 02 12 14 15 16 17 18 19 20 22 weak expression: see section 05 06 07 08 09 11 21
urethra of male
moderate moderate
homogeneousmoderate expression: see section 14
lung
strong strong
spottedstrong expression: see section 18 19 20 22 moderate expression: see section 03 04 05 06 07 08 09 11 12 14 15 16 17 21 weak expression: see section 10
nucleus pulposus
moderate moderate
homogeneousmoderate expression: see section 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1664
Entity Detected:Fam55b, family with sequence similarity 55, member B ( MGI:1925502)
Sequence:sense strand is shown

>T1664
TGGCCTCGAGCCAGATTCGGCACGAGGGAGCATTGTCTATCAGGGCTGTGGAGAGAGTTACACAGTTAAA
GGCTTCTCTCCTCTTCTAAGCTTGATGTTTAAATAGTAAATTATCATCAGCCATCTCTTACTTTTTAAAT
ATTATTTAATTATTTATGTGTACGTGTGAGTGTCTGTCAATGAACATCAGGTGTGTTTGACGGATGTCTT
GCAGAGGCCAGAAGAGGGTTTCAGATCCTCTGGAGCTGGAATTATGGGGTGGTTGTGACTTGCCCAATGT
GGGTTCTAGGAACTGAACTTGGGTCCTCTGGAAGTGTGGCCATCACTCCAGCCAGCACTCTCCTTACTTT
AAAGGCATGTGCAGTCCAGAGACACATAGCTTTAATGATCTGCTCAGAGAAAAGATAATGCTTAGAAGAA
AACTTCACAGAACCATAATAGCAGGGTTCTTGCTTAGAAAAATTCCTTAAGATTTGATAACCAGTTGTTG
CTTGGATTCCACTGGGATTCAGTAGCCACAGTCCAAAGTCCACAAACTCACTGTGTGAAATCAACTTCAC
ATTATGAGACTAT
Notes:The probe template was PCR amplified from IMAGE:465511 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:465511 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10115 same embryo
 EMAGE:10113 same embryo
 EMAGE:10114 same embryo
 EMAGE:10112 same embryo
 EurExpress:euxassay_000105 same experiment
 MGI:4824747 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS