Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10146

Fap fibroblast activation protein ( MGI:109608)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10146 EMAGE:10146 EMAGE:10146 EMAGE:10146 EMAGE:10146
"Pseudo-wholemount" of euxassay_000113. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000113_01 euxassay_000113_02 euxassay_000113_03 euxassay_000113_04
EMAGE:10146 EMAGE:10146 EMAGE:10146 EMAGE:10146 EMAGE:10146
euxassay_000113_05 euxassay_000113_06 euxassay_000113_07 euxassay_000113_08 euxassay_000113_09
EMAGE:10146 EMAGE:10146 EMAGE:10146 EMAGE:10146 EMAGE:10146
euxassay_000113_10 euxassay_000113_11 euxassay_000113_12 euxassay_000113_13 euxassay_000113_14
EMAGE:10146 EMAGE:10146 EMAGE:10146 EMAGE:10146 EMAGE:10146
euxassay_000113_15 euxassay_000113_16 euxassay_000113_17 euxassay_000113_18 euxassay_000113_19
EMAGE:10146 EMAGE:10146 EMAGE:10146 EMAGE:10146 EMAGE:10146
euxassay_000113_20 euxassay_000113_21 euxassay_000113_22 euxassay_000113_23 euxassay_000113_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10146Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10146_wholemount_strong.wlz
10146_wholemount_moderate.wlz
10146_wholemount_weak.wlz
10146_wholemount_possible.wlz
10146_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10146_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diaphragm
strong strong
regionalstrong expression: see section 08 moderate expression: see section 06 07
pleuro-pericardial folds
weak weak
regionalweak expression: see section 05 06
diaphragm mesothelium
moderate moderate
homogeneousmoderate expression: see section 20
pericardial cavity
moderate moderate
regionalmoderate expression: see section 03
peritoneal component
moderate moderate
regionalmoderate expression: see section 03 08
greater sac mesothelium
moderate moderate
homogeneousmoderate expression: see section 08 17 18 19
greater sac parietal mesothelium
strong strong
homogeneousstrong expression: see section 23 moderate expression: see section 19 20 21 22 24
greater sac visceral mesothelium
strong strong
homogeneousstrong expression: see section 23 moderate expression: see section 15 19 20 21 22
omental bursa mesothelium
moderate moderate
regionalmoderate expression: see section 08 17
omental bursa parietal mesothelium
strong strong
homogeneousstrong expression: see section 23 moderate expression: see section 18 19 20 21 22
pleura
moderate moderate
regionalmoderate expression: see section 07 08
parietal pleura
moderate moderate
homogeneousmoderate expression: see section 11
visceral pleura
moderate moderate
homogeneousmoderate expression: see section 11 12
interdigital region between hindlimb digits 1 and 2
strong strong
regionalstrong expression: see section 01 05 06
interdigital region between hindlimb digits 2 and 3
strong strong
regionalstrong expression: see section 01 05 06 07
interdigital region between hindlimb digits 3 and 4
strong strong
regionalstrong expression: see section 05 06 07
interdigital region between hindlimb digits 4 and 5
strong strong
regionalstrong expression: see section 06 07
interdigital region between hindlimb digits 4 and 5 mesenchyme
strong strong
regionalstrong expression: see section 06
foot mesenchyme
strong strong
regionalstrong expression: see section 01 06
mesenchyme
strong strong
regionalstrong expression: see section 05 19
head mesenchyme
strong strong
regionalstrong expression: see section 05 moderate expression: see section 09
trunk mesenchyme
strong strong
regionalstrong expression: see section 04 05 moderate expression: see section 09
body-wall mesenchyme
strong strong
regionalstrong expression: see section 01 04 moderate expression: see section 09 11 22 23 24
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 04
anterior abdominal wall musculature
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 04 08 09
axial musculature
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09
pectoral girdle and thoracic body wall musculature
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 07 09
pectoral girdle and thoracic body wall muscle
moderate moderate
regionalmoderate expression: see section 04
pelvic girdle musculature
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09
sublingual gland primordium mesenchyme
strong strong
regionalstrong expression: see section 20 21 22 moderate expression: see section 13 14 15 16 18 19
submandibular gland primordium mesenchyme
strong strong
regionalstrong expression: see section 09 10 11 20 21 22 moderate expression: see section 12 13 14 15 16 18 19
gut
strong strong
homogeneousstrong expression: see section 01 04 05 06 07 08 09 10 moderate expression: see section 03
central nervous system
strong strong
regionalstrong expression: see section 14
brain
strong strong
regionalstrong expression: see section 13 14 15 16 17
physiological umbilical hernia
strong strong
regionalstrong expression: see section 18 20 moderate expression: see section 15 21
physiological umbilical hernia dermis
strong strong
homogeneousstrong expression: see section 18
lens
strong strong
homogeneousstrong expression: see section 02
nasal capsule
strong strong
regionalstrong expression: see section 13
nasal cavity
strong strong
regionalstrong expression: see section 12 17
nasal cavity epithelium
strong strong
regionalstrong expression: see section 12
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 13 14
nasal septum
strong strong
homogeneousstrong expression: see section 15 16 17
nasal septum mesenchyme
strong strong
homogeneousstrong expression: see section 16
lower jaw mesenchyme
strong strong
regionalstrong expression: see section 23 moderate expression: see section 16
palatal shelf mesenchyme
strong strong
regionalstrong expression: see section 15
axial skeleton
strong strong
homogeneousstrong expression: see section 09 10 11 13 16 17 18 20
viscerocranium
strong strong
homogeneousstrong expression: see section 18
ethmoid bone primordium
strong strong
regionalstrong expression: see section 24
facial bone primordium
strong strong
regionalstrong expression: see section 05 07 24 moderate expression: see section 06
optic foramen
strong strong
regionalstrong expression: see section 03
orbital fissure
strong strong
regionalstrong expression: see section 03 04 24
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 04 05 06 07 10 11 12 18 19 21 22 23 24 moderate expression: see section 08 20
viscerocranium
strong strong
regionalExpression in the turbinate bone.
pectoral girdle and thoracic body wall skeleton
strong strong
regionalstrong expression: see section 04
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 15
tail paraxial mesenchyme
strong strong
regionalstrong expression: see section 17 moderate expression: see section 15 16 18
axial skeleton tail region
strong strong
homogeneousstrong expression: see section 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T402
Entity Detected:Fap, fibroblast activation protein ( MGI:109608)
Sequence:sense strand is shown

>T402
ATTTATTTGAAACAAAGACCAGGAGATCCACCTTTTCAAATAACTTATACTGGAAGAGAAAATACGAATA
TTTAATGGAATACCAGACTGGGTTTATGAAGAGGAAATGCTTGCCACAAAATATGCTCTTTGGTGGTCTC
CAGATGGAAAATTTTTGGCATATGTAGAATTTAATGATTCAGATATACCAATTATTGCCTATTCTTATTA
TGGTGATGGACAGTATCCTAGAACTATAAATATTCCATATCCAAAGGCTGGGGCTAAGAATCCGGTTGTT
CGTGTTTTTATTGTTGACACCACCTACCCTCACCACGTGGGCCCAATGGAAGTGCCAGTTCCAGAAATGA
TAGCCTCAAGTGACTATTATTTCAGCTGGCTCACATGGGTGTCCAGTGAACGAGTATGCTTGCAGTGGCT
AAAAAGAGTGCAGAATGTCTCAGTCCTGTCTATATGTGATTTCANGGAAGACTGGCATGCATGGG
Notes:The probe template was PCR amplified from IMAGE:3157072 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3157072 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10147 same embryo
 EurExpress:euxassay_000113 same experiment
 MGI:4824777 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS