Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10155

Tmem14c transmembrane protein 14C ( MGI:1913404)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10155 EMAGE:10155 EMAGE:10155 EMAGE:10155 EMAGE:10155
"Pseudo-wholemount" of euxassay_000161. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000161_01 euxassay_000161_02 euxassay_000161_03 euxassay_000161_04
EMAGE:10155 EMAGE:10155 EMAGE:10155 EMAGE:10155 EMAGE:10155
euxassay_000161_05 euxassay_000161_06 euxassay_000161_07 euxassay_000161_08 euxassay_000161_09
EMAGE:10155 EMAGE:10155 EMAGE:10155 EMAGE:10155 EMAGE:10155
euxassay_000161_10 euxassay_000161_11 euxassay_000161_12 euxassay_000161_13 euxassay_000161_14
EMAGE:10155 EMAGE:10155 EMAGE:10155 EMAGE:10155 EMAGE:10155
euxassay_000161_15 euxassay_000161_16 euxassay_000161_17 euxassay_000161_18 euxassay_000161_19
EMAGE:10155 EMAGE:10155 EMAGE:10155 EMAGE:10155 EMAGE:10155
euxassay_000161_20 euxassay_000161_21 euxassay_000161_22 euxassay_000161_23 euxassay_000161_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10155Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10155_wholemount_strong.wlz
10155_wholemount_moderate.wlz
10155_wholemount_weak.wlz
10155_wholemount_possible.wlz
10155_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10155_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
biceps brachii
moderate moderate
homogeneousmoderate expression: see section 01
brachialis
moderate moderate
homogeneousmoderate expression: see section 01
teres major
moderate moderate
homogeneousmoderate expression: see section 01
triceps brachii
moderate moderate
homogeneousmoderate expression: see section 01
hamstring muscle
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 08 moderate expression: see section 01
quadriceps femoris muscle
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 08 moderate expression: see section 01
anterior abdominal wall muscle
strong strong
homogeneousstrong expression: see section 07
external oblique muscle
strong strong
homogeneousstrong expression: see section 02 03 05 moderate expression: see section 01
rectus abdominis
strong strong
homogeneousstrong expression: see section 02 03 05
transversus abdominis
moderate moderate
homogeneousmoderate expression: see section 01
erector spinae
strong strong
homogeneousstrong expression: see section 06 09
ilio-psoas
strong strong
homogeneousstrong expression: see section 09
quadratus lumborum
strong strong
homogeneousstrong expression: see section 07 08
serratus ventralis
strong strong
homogeneousstrong expression: see section 04 05 06 07
masseter
strong strong
homogeneousstrong expression: see section 02 03 08
mylohyoid
strong strong
homogeneousstrong expression: see section 02 03 05 06 08
deltoid
strong strong
homogeneousstrong expression: see section 02 03 05 06 moderate expression: see section 01
infraspinatus
strong strong
homogeneousstrong expression: see section 05 06
latissimus dorsi
strong strong
homogeneousstrong expression: see section 05 06
pectoralis major
strong strong
homogeneousstrong expression: see section 06 07 08 09 10
pectoralis minor
strong strong
homogeneousstrong expression: see section 06 07 08 09 10
subscapularis
strong strong
homogeneousstrong expression: see section 02 03 05 06 07 moderate expression: see section 01
supraspinatus
strong strong
homogeneousstrong expression: see section 02 03 05 06 moderate expression: see section 01
trapezius
strong strong
homogeneousstrong expression: see section 02 03 05 06 07
gluteus maximus
strong strong
homogeneousstrong expression: see section 02 04 05 06
thymus primordium
weak weak
regionalweak expression: see section 14
sublingual gland primordium
strong strong
regionalstrong expression: see section 10 12
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 10 11 21 moderate expression: see section 22
vibrissa
strong strong
regionalstrong expression: see section 08 22 23 moderate expression: see section 05 07 weak expression: see section 06
telencephalon
strong strong
homogeneousstrong expression: see section 17
cerebral cortex
moderate moderate
homogeneousmoderate expression: see section 16 18
cerebral cortex marginal layer
strong strong
homogeneousstrong expression: see section 22 23 moderate expression: see section 19 20
cerebral cortex ventricular layer
strong strong
homogeneousstrong expression: see section 11 22 23 moderate expression: see section 19 20 21
telencephalon marginal layer
strong strong
homogeneousstrong expression: see section 04 06 07 17 moderate expression: see section 02 03 05 08 10 11 12 15 16
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 17 moderate expression: see section 03 04 05 09 10 11 12 16 18 weak expression: see section 02 06 07 08
metencephalon floor plate
moderate moderate
homogeneousmoderate expression: see section 11
metencephalon basal plate
moderate moderate
homogeneousmoderate expression: see section 11
midbrain
moderate moderate
homogeneousmoderate expression: see section 17
midbrain floor plate
strong strong
homogeneousstrong expression: see section 14 moderate expression: see section 11 13 16
midbrain lateral wall
strong strong
homogeneousstrong expression: see section 14 15 moderate expression: see section 16 17 18
midbrain mantle layer
moderate moderate
homogeneousmoderate expression: see section 13
midbrain ventricular layer
moderate moderate
homogeneousmoderate expression: see section 11
midbrain roof plate
strong strong
homogeneousstrong expression: see section 14
tegmentum
moderate moderate
homogeneousmoderate expression: see section 13
facial vii ganglion
strong strong
homogeneousstrong expression: see section 22
glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 10 21
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 04 05 06 07 08 09 10 19 21 22 moderate expression: see section 20
vagus x ganglion
strong strong
homogeneousstrong expression: see section 08 09 10 21 22
vestibulocochlear viii ganglion
strong strong
homogeneousstrong expression: see section 05 06 07 08 21 22
vestibulocochlear viii ganglion vestibular component
strong strong
homogeneousstrong expression: see section 05
spinal cord
moderate moderate
homogeneousmoderate expression: see section 15 16 17
dorsal root ganglion
strong strong
homogeneousstrong expression: see section 11 13 19 moderate expression: see section 20
inner ear
moderate moderate
regionalmoderate expression: see section 02 03 04
labyrinth
moderate moderate
regionalmoderate expression: see section 02 03 04 05 07
otic capsule
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07
inner ear vestibular component
moderate moderate
regionalmoderate expression: see section 04
middle ear
weak weak
regionalweak expression: see section 01
retina
strong strong
regionalstrong expression: see section 01
neural retina
strong strong
regionalstrong expression: see section 02 03
naso-lacrimal duct
moderate moderate
homogeneousmoderate expression: see section 04 05
genioglossus
strong strong
spottedstrong expression: see section 14 15
hyoglossus
strong strong
homogeneousstrong expression: see section 18
palatoglossus
strong strong
homogeneousstrong expression: see section 18
styloglossus
strong strong
spottedstrong expression: see section 11
tongue intrinsic muscle
strong strong
spottedstrong expression: see section 12 14 15
tongue intrinsic muscle transverse component
strong strong
spottedstrong expression: see section 11 13 14 15 16 17 18
tongue intrinsic muscle vertical component
strong strong
spottedstrong expression: see section 11 12 13 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1641
Entity Detected:Tmem14c, transmembrane protein 14C ( MGI:1913404)
Sequence:sense strand is shown

>T1641
TGGCCTCGAGCCAGATTCGGACGAGGCTGNCTGCTCGCGCCCTCGTCCTACAGCACAGGCCTCCCGGCTC
CGGCTCCGGCTCCAGTGTTGGTTGGGTGCAGGCCTGGTGTGGTCTCCAAAGCGACTGAACAATGCAGAAA
GACAGTGGCCCATTGATGCCTTTACATTATTTTGGTTTCGGCTATGCAGCCCTGGTTGCTACCGGTGGGA
TTATTGGCTATGCCAAAGCAGGTAGTGTGCCGTCCCTGGCTGCTGGACTCTTCTTCGGGGGCCTGGCAGG
CCTGGGGGCCTACCAGCTGTCTCAGGATCCCAGGAATGTGTGGGTTTTCCTAGCTACATCTGGGACCTTG
GCCGGAATTATGGGGATGAGATTCTACAACTCGGGGAAATTTATGCCTGCAGGGTTAATCGCAGGAGCCA
GTTTGCTGATGGTTGCCAAAGTTGGAATTANTCTGTTGAGTTCACCTCATCCGTAACAGCTGTAACCCCG
AGTGGGCTCGTGAAGACTTGAAGCTCTCCAGACCTCCACATTACAATGTTGAAGAGATA
Notes:The probe template was PCR amplified from IMAGE:456666 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:456666 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10154 same embryo
 EMAGE:10158 same embryo
 EMAGE:10153 same embryo
 EMAGE:10156 same embryo
 EMAGE:10157 same embryo
 EurExpress:euxassay_000161 same experiment
 MGI:4828777 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS