Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10157

Tle2 transducin-like enhancer of split 2, homolog of Drosophila E(spl) ( MGI:104635)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10157 EMAGE:10157 EMAGE:10157 EMAGE:10157 EMAGE:10157
"Pseudo-wholemount" of euxassay_018941. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018941_01 euxassay_018941_02 euxassay_018941_03 euxassay_018941_04
EMAGE:10157 EMAGE:10157 EMAGE:10157 EMAGE:10157 EMAGE:10157
euxassay_018941_05 euxassay_018941_06 euxassay_018941_07 euxassay_018941_08 euxassay_018941_09
EMAGE:10157 EMAGE:10157 EMAGE:10157 EMAGE:10157 EMAGE:10157
euxassay_018941_10 euxassay_018941_11 euxassay_018941_12 euxassay_018941_13 euxassay_018941_14
EMAGE:10157 EMAGE:10157 EMAGE:10157 EMAGE:10157 EMAGE:10157
euxassay_018941_15 euxassay_018941_16 euxassay_018941_17 euxassay_018941_18 euxassay_018941_19
EMAGE:10157 EMAGE:10157 EMAGE:10157 EMAGE:10157 EMAGE:10157
euxassay_018941_20 euxassay_018941_21 euxassay_018941_22 euxassay_018941_23 euxassay_018941_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10157Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10157_wholemount_strong.wlz
10157_wholemount_moderate.wlz
10157_wholemount_weak.wlz
10157_wholemount_possible.wlz
10157_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10157_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 1 phalanx
weak weak
regionalweak expression: see section 03 04 05 24
hindlimb digit 2 phalanx
weak weak
regionalweak expression: see section 03 04 05 23 24
hindlimb digit 3 phalanx
weak weak
regionalweak expression: see section 03 04 06 07 23
hindlimb digit 4 phalanx
weak weak
regionalweak expression: see section 03 04 06 07 23
hindlimb digit 5 phalanx
weak weak
regionalweak expression: see section 06 23
spleen primordium
strong strong
regionalstrong expression: see section 05 moderate expression: see section 06 07 weak expression: see section 04
thyroid gland
weak weak
regionalweak expression: see section 13 18
vibrissa
moderate moderate
regionalmoderate expression: see section 07 08 23 24 weak expression: see section 09 22
hypothalamus mantle layer
weak weak
regionalweak expression: see section 11 12 13 14 16 17 18 19 20
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 14
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 10 11 12 13 16 17 18 19 20
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 14
cerebral cortex mantle layer
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 18 19 20 21 22 23 24
medulla oblongata floor plate
moderate moderate
regionalmoderate expression: see section 14 15
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 09 11 18 19 20 21
metencephalon floor plate
moderate moderate
regionalmoderate expression: see section 14 15
pons mantle layer
weak weak
regionalweak expression: see section 08 09 10 11 18 19 20 21 22
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 10 11 12 13 14 16 18 19 20 21
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 16
facial vii ganglion
strong strong
regionalstrong expression: see section 06 moderate expression: see section 07 23 24
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 23 24
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 11 19 20
extrinsic ocular muscle
weak weak
regionalweak expression: see section 06 07 08 23
heart valve
weak weak
regionalweak expression: see section 13 14 16 17
lower lip
weak weak
regionalweak expression: see section 10 11 13 14 15 16 17 18 19 20 23
upper lip
weak weak
regionalweak expression: see section 10 11 12 13 18 19 20 23 24
metanephros
weak weak
regionalweak expression: see section 10 11 20 21 22 23
urethra of male
weak weak
regionalweak expression: see section 14 15 16
lung
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T51142
Entity Detected:Tle2, transducin-like enhancer of split 2, homolog of Drosophila E(spl) ( MGI:104635)
Sequence:sense strand is shown

>T51142
CCCTATCTGGGGCACTGGCTGCGCAGGCCCAGCTGGTGGCTGCCGTAAAGGAAGACCGTGTGGGTGTGGA
CGCCGAGGGGTCCAGAGTGGACAGAGCTGCCAGCAGGAGTTCTTCCCCGTCTCCCCCTGAGAGTCTGGTG
GAAGAGGACCATCCCAGCAGCCGAGGCGGCAGTGGGAAACAGCAGAGAGCTGAAGACAAGGATCTGTCAG
GGCCTTATGACAGTGAGGAAGACAAGAGTGACTATAACCTGGTAGTGGATGAGGACCAACCGTCAGAGCC
CCCCAGCCCTGTGACCACCCCTTGTGGGAAGGCGCCCCTCTGCATTCCTGCCCGCAGGGACCTCACAGAC
AGTCCAGCCTCCTTGGCCTCCAGTTTGGGCTCACCACTCCCCAGAAGCAAAGACATAGCCCTGAACGATC
TTCCCACAGGCACTCCTGCCTCCAGGTCATGTGGTACCTCTCCACCCCAGGACTCGTCCACCCCGGGGCC
CAGCTCAGCCAGTCACCTCTGCCAGCTGGCGGCTCAGCCGGCAGCACCCACAGACAGCATCGCCCTGAGG
AGTCCCCTGACCTTGTCCAGCCCTTTCACCTCATCCTTCAGCCTGGGCTCCCACAGCACCCTCAATGGGG
ACCTCTCCATGCCTGGCTCCTATGTCGGCCTCCACCTGTCCCCCCAGGTCAGCAGCTCTGTCGTGTATGG
ACGCT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:CCCTATCTGGGGCACTGG; Reverse Primer - name:unspecified, sequence:AGCGTCCATACACGACAGA. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10154 same embryo
 EMAGE:10158 same embryo
 EMAGE:10155 same embryo
 EMAGE:10153 same embryo
 EMAGE:10156 same embryo
 EurExpress:euxassay_018941 same experiment
 MGI:4828734 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS