Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10159

Ccl2 chemokine (C-C motif) ligand 2 ( MGI:98259)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10159 EMAGE:10159 EMAGE:10159 EMAGE:10159 EMAGE:10159
"Pseudo-wholemount" of euxassay_000140. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000140_01 euxassay_000140_02 euxassay_000140_03 euxassay_000140_04
EMAGE:10159 EMAGE:10159 EMAGE:10159 EMAGE:10159 EMAGE:10159
euxassay_000140_05 euxassay_000140_06 euxassay_000140_07 euxassay_000140_08 euxassay_000140_09
EMAGE:10159 EMAGE:10159 EMAGE:10159 EMAGE:10159 EMAGE:10159
euxassay_000140_10 euxassay_000140_11 euxassay_000140_12 euxassay_000140_13 euxassay_000140_14
EMAGE:10159 EMAGE:10159 EMAGE:10159 EMAGE:10159 EMAGE:10159
euxassay_000140_15 euxassay_000140_16 euxassay_000140_17 euxassay_000140_18 euxassay_000140_19
EMAGE:10159 EMAGE:10159 EMAGE:10159 EMAGE:10159 EMAGE:10159
euxassay_000140_20 euxassay_000140_21 euxassay_000140_22 euxassay_000140_23 euxassay_000140_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10159Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10159_wholemount_strong.wlz
10159_wholemount_moderate.wlz
10159_wholemount_weak.wlz
10159_wholemount_possible.wlz
10159_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10159_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vibrissa
moderate moderate
regionalmoderate expression: see section 05
telencephalon
strong strong
homogeneousstrong expression: see section 06 07 moderate expression: see section 04 22 24
cerebral cortex
moderate moderate
regionalmoderate expression: see section 04
cerebral cortex marginal layer
strong strong
homogeneousstrong expression: see section 08 11 14 15 16 17 18 moderate expression: see section 12 20 21 23 24
cerebral cortex ventricular layer
strong strong
homogeneousstrong expression: see section 09
corpus striatum
moderate moderate
regionalmoderate expression: see section 04
telencephalon mantle layer
strong strong
homogeneousstrong expression: see section 15 moderate expression: see section 20
telencephalon marginal layer
strong strong
homogeneousstrong expression: see section 05 06 07 08 09 11 14 16 17 19 moderate expression: see section 12 21 22
olfactory cortex marginal layer
strong strong
homogeneousstrong expression: see section 08 09 11 14 15 16 17 18 moderate expression: see section 12 20 21
metencephalon alar plate
moderate moderate
homogeneousmoderate expression: see section 06 07 08
metencephalon basal plate
strong strong
homogeneousstrong expression: see section 11 moderate expression: see section 06 07 08
midbrain marginal layer
strong strong
homogeneousstrong expression: see section 16 17 18 19
central nervous system ganglion
strong strong
homogeneousstrong expression: see section 06
cranial ganglion
strong strong
homogeneousstrong expression: see section 06 moderate expression: see section 22
facial vii ganglion
strong strong
homogeneousstrong expression: see section 07 08 moderate expression: see section 21
glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 07 08 20 moderate expression: see section 21
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 05 07 08 09 20 24 moderate expression: see section 04 18 19 21 22 23
vagus x ganglion
strong strong
homogeneousstrong expression: see section 08 20 moderate expression: see section 19 21
vestibulocochlear viii ganglion
strong strong
spottedstrong expression: see section 08
central nervous system nerve
strong strong
homogeneousstrong expression: see section 06
facial vii nerve
strong strong
spottedstrong expression: see section 08
glossopharyngeal ix nerve
strong strong
spottedstrong expression: see section 08
optic ii nerve
strong strong
spottedstrong expression: see section 08 moderate expression: see section 23
trigeminal v nerve mandibular division
strong strong
spottedstrong expression: see section 08 11
trigeminal v nerve maxillary division
strong strong
spottedstrong expression: see section 08 09
trigeminal v nerve ophthalmic division
strong strong
homogeneousstrong expression: see section 08 09 moderate expression: see section 23
spinal cord
strong strong
homogeneousstrong expression: see section 11 14 18 moderate expression: see section 12 15 16 17
spinal component of peripheral nervous system
strong strong
homogeneousstrong expression: see section 11
dorsal root ganglion
strong strong
homogeneousstrong expression: see section 11 14 17 18 20 moderate expression: see section 15 16
retina
strong strong
regionalstrong expression: see section 23 24 moderate expression: see section 01 02
heart
moderate moderate
single cellmoderate expression: see section 07 08
heart ventricle
moderate moderate
single cellmoderate expression: see section 07 08
lung
strong strong
regionalstrong expression: see section 07 08 moderate expression: see section 11 12 20 24 weak expression: see section 18 not detected expression: see section 21
nucleus pulposus
moderate moderate
homogeneousmoderate expression: see section 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1793
Entity Detected:Ccl2, chemokine (C-C motif) ligand 2 ( MGI:98259)
Sequence:sense strand is shown

>T1793
TGGCCTCGAGCCAGATTCGGCACGAGGGGCCAGCCCAGCACCAGCACCAGCCAACTCTCACTGAAGCCAG
CTCTCTCTTCCTCCACCACCATGCAGGTCCCTGTCATGCTTCTGGGCCTGCTGTTCACAGTTGCCGGCTG
GAGCATCCACGTGTTGGCTCAGCCAGATGCAGTTAACGCCCCACTCACCTGCTGCTACTCATTCACCAGC
AAGATGATCCCAATGAGTAGGCTGGAGAGCTACAAGAGGATCACCAGCAGCAGGTGTCCCAAAGAAGCTG
TAGTTTTTGTCACCAAGCTCAAGAGAGAGGTCTGTGCTGACCCCAAGAAGGAATGGGTCCAGACATACAT
TAAAAACCTGGATCGGAACCAAATGAGATCAGAACCTACAACTTTATTTAAAACTGCATCTGCCCTAAGG
TCTTCAGCACCTTTGAATGTGAAGTTGACCCGTAAATCTGAAGCTAATGCATCCACTACCTTTTCCACAA
CCACCTCAAGCACTTCTGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTT
AA
Notes:The probe template was PCR amplified from IMAGE:573898 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:573898 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10160 same embryo
 EurExpress:euxassay_000140 same experiment
 MGI:4823699 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS