Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10188

Scg3 secretogranin III ( MGI:103032)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10188 EMAGE:10188 EMAGE:10188 EMAGE:10188 EMAGE:10188
"Pseudo-wholemount" of euxassay_000012. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000012_01 euxassay_000012_02 euxassay_000012_03 euxassay_000012_04
EMAGE:10188 EMAGE:10188 EMAGE:10188 EMAGE:10188 EMAGE:10188
euxassay_000012_05 euxassay_000012_06 euxassay_000012_07 euxassay_000012_08 euxassay_000012_09
EMAGE:10188 EMAGE:10188 EMAGE:10188 EMAGE:10188 EMAGE:10188
euxassay_000012_10 euxassay_000012_11 euxassay_000012_12 euxassay_000012_13 euxassay_000012_14
EMAGE:10188 EMAGE:10188 EMAGE:10188 EMAGE:10188 EMAGE:10188
euxassay_000012_15 euxassay_000012_16 euxassay_000012_17 euxassay_000012_18 euxassay_000012_19
EMAGE:10188 EMAGE:10188 EMAGE:10188
euxassay_000012_20 euxassay_000012_21 euxassay_000012_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10188Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10188_wholemount_strong.wlz
10188_wholemount_moderate.wlz
10188_wholemount_weak.wlz
10188_wholemount_possible.wlz
10188_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10188_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
adrenal gland
moderate moderate
spottedmoderate expression: see section 08 10 14 16
adrenal medulla
moderate moderate
spottedmoderate expression: see section 08 16
gut
moderate moderate
regionalmoderate expression: see section 08
central nervous system
strong strong
gradedstrong expression: see section 06
brain
strong strong
gradedstrong expression: see section 10
forebrain
strong strong
gradedstrong expression: see section 05 06 10 13
diencephalon
strong strong
gradedstrong expression: see section 10
telencephalon
strong strong
gradedstrong expression: see section 05 06 07 10 13
cerebral cortex
strong strong
gradedstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 20 21 22
cerebral cortex mantle layer
strong strong
gradedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 14 17
cerebral cortex marginal layer
strong strong
gradedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 20 21 22
hindbrain
strong strong
homogeneousstrong expression: see section 09 12
cerebellum
strong strong
gradedstrong expression: see section 02 03 04 08 09 11 12 13 14 20 21
cerebellum intraventricular portion
strong strong
homogeneousstrong expression: see section 03
midbrain
strong strong
gradedstrong expression: see section 09 10 12
midbrain lateral wall
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
midbrain mantle layer
strong strong
gradedstrong expression: see section 06 07 08 09 10 14
midbrain marginal layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15
central nervous system ganglion
strong strong
homogeneousstrong expression: see section 16
cranial ganglion
strong strong
homogeneousstrong expression: see section 16 17
facial vii ganglion
strong strong
homogeneousstrong expression: see section 15 16 17
glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 13 14 15 16 17
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 09 11 16 17 20 21 weak expression: see section 22
vagus x ganglion
strong strong
homogeneousstrong expression: see section 05 06 07 13 14 15 16 17 not examined expression: see section 03
vestibulocochlear viii ganglion
strong strong
homogeneousstrong expression: see section 06 16 17
trigeminal v nerve
strong strong
homogeneousstrong expression: see section 08 09
trigeminal v nerve maxillary division
strong strong
homogeneousstrong expression: see section 08 09
spinal cord
strong strong
homogeneousstrong expression: see section 12 moderate expression: see section 11
spinal cord lateral wall
strong strong
homogeneousstrong expression: see section 12 moderate expression: see section 11
spinal cord mantle layer
strong strong
homogeneousstrong expression: see section 09
basal columns
strong strong
homogeneousstrong expression: see section 09 10
autonomic nervous system
strong strong
homogeneousstrong expression: see section 09
sympathetic nervous system
strong strong
homogeneousstrong expression: see section 09 10
sympathetic ganglion
strong strong
homogeneousstrong expression: see section 10
cervico-thoracic ganglion
strong strong
homogeneousstrong expression: see section 09 10
cervical ganglion
strong strong
homogeneousstrong expression: see section 09 10
thoracic ganglion
strong strong
homogeneousstrong expression: see section 09 10
spinal component of peripheral nervous system
strong strong
homogeneousstrong expression: see section 06 09 13 14 15 16
spinal ganglion
strong strong
homogeneousstrong expression: see section 06 07 08 09 12 14 17
dorsal root ganglion
strong strong
homogeneousstrong expression: see section 05 06 07 08 09 14 15 16 17
spinal nerve plexus
strong strong
homogeneousstrong expression: see section 12 13
retina
strong strong
homogeneousstrong expression: see section 03
neural retina
strong strong
homogeneousstrong expression: see section 02 03
heart
weak weak
single cellweak expression: see section 09 10 11 13 14 17
stomach
strong strong
regionalstrong expression: see section 03 05 moderate expression: see section 04
urinary system
strong strong
homogeneousstrong expression: see section 16
bladder
strong strong
homogeneousstrong expression: see section 16
metanephros
moderate moderate
spottedmoderate expression: see section 16
lung
strong strong
spottedstrong expression: see section 03 04 05 06 07 08 11 moderate expression: see section 14 15 16 17 20 weak expression: see section 21
left lung
strong strong
spottedstrong expression: see section 03
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1677
Entity Detected:Scg3, secretogranin III ( MGI:103032)
Sequence:sense strand is shown

>T1677
TGGCCTCGAGCCAGATTCGGCCGAGGAGGAACTCCGTATTTCCCCAACTTCTATGCACTACTGACAAGCA
TCGACTCAGAAAAAGAAGCAAAAGAGAAAGAAACCCTGATCACCATCATGAAGACATTGATTGACTTCGT
GAAAATGATGGTGAAATACGGTACGATATCTCCAGAGGAAGGCGTGTCCTACCTTGAAAACTTGGATGAA
ACAATTGCTCTGCAGACCAAGAACAAGCTAGAAAAAAATACTACTGATAGCAAAACTCCACCAGAGAAGA
GTCAGGAAGAAACAGACAGTACCAAGGAAGAAGCCGCCAAGATGGAAAAGGAATACGGAAGCCTAAAAGA
CTCTACAAAAGATGATAACTCCAACCTAGGAGGAAAGACAGATGAAGCCACAGGGAAGACAGAAGCCTAC
TTGGAAGCCATTAGAAAAAACATCGAATGGCTGAAGAAACATAACAAGAAGGGCAACAAAGAAGATTACG
ACCTTTCAAAGATGAGGGACTTTATCAACCAACAAGCTGACGCTTATGTGGAGAAGGG
Notes:The probe template was PCR amplified from IMAGE:475013 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:475013 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10189 same embryo
 EMAGE:10186 same embryo
 EMAGE:10187 same embryo
 EurExpress:euxassay_000012 same experiment
 MGI:4827895 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS