Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10231

Acsl5 acyl-CoA synthetase long-chain family member 5 ( MGI:1919129)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10231 EMAGE:10231 EMAGE:10231 EMAGE:10231 EMAGE:10231
"Pseudo-wholemount" of euxassay_018902. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018902_01 euxassay_018902_02 euxassay_018902_03 euxassay_018902_04
EMAGE:10231 EMAGE:10231 EMAGE:10231 EMAGE:10231 EMAGE:10231
euxassay_018902_05 euxassay_018902_06 euxassay_018902_07 euxassay_018902_08 euxassay_018902_09
EMAGE:10231 EMAGE:10231 EMAGE:10231 EMAGE:10231 EMAGE:10231
euxassay_018902_10 euxassay_018902_11 euxassay_018902_12 euxassay_018902_13 euxassay_018902_14
EMAGE:10231 EMAGE:10231 EMAGE:10231 EMAGE:10231 EMAGE:10231
euxassay_018902_15 euxassay_018902_16 euxassay_018902_17 euxassay_018902_18 euxassay_018902_19
EMAGE:10231 EMAGE:10231 EMAGE:10231 EMAGE:10231 EMAGE:10231
euxassay_018902_20 euxassay_018902_21 euxassay_018902_22 euxassay_018902_23 euxassay_018902_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10231Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10231_wholemount_strong.wlz
10231_wholemount_moderate.wlz
10231_wholemount_weak.wlz
10231_wholemount_possible.wlz
10231_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10231_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
axial musculature
weak weak
regionalweak expression: see section 06 07 24
adrenal gland
moderate moderate
regionalmoderate expression: see section 09 10 11 weak expression: see section 18 19 20 21
thymus primordium
strong strong
regionalstrong expression: see section 13 14 15 16 17
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 10 11 19 20 21 22 moderate expression: see section 18
pancreas
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 16 weak expression: see section 17 18
thyroid gland
moderate moderate
regionalmoderate expression: see section 13 17 weak expression: see section 12 18
vibrissa
weak weak
regionalweak expression: see section 05 06 07 21 22 23
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 10 11 18 19
pons mantle layer
weak weak
regionalweak expression: see section 08 19
ventral grey horn
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 14 15 16 17 18
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 12 19
cervical ganglion
weak weak
regionalweak expression: see section 11 19
thoracic ganglion
weak weak
regionalweak expression: see section 14 15
dorsal root ganglion
weak weak
regionalweak expression: see section 11 12 13 16 17 18 19 20 21
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 02 03 04 05 23
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 moderate expression: see section 08 11 12 13 15 17 18 19 20 weak expression: see section 16
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 12 13 weak expression: see section 16
esophagus
moderate moderate
regionalmoderate expression: see section 14 15 16
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 04 06 07 08 09 10
hindgut
strong strong
regionalstrong expression: see section 12 13 14 15
midgut
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
mandible
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 13 19 20 21 22 23 24
maxilla
weak weak
regionalweak expression: see section 06 09 10 19 20 21 22
liver
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
bladder
strong strong
regionalstrong expression: see section 13 14 15
metanephros
weak weak
regionalweak expression: see section 07 08 09 10 11 12 18 21 22 23
urethra of male
moderate moderate
regionalmoderate expression: see section 13 14
larynx
moderate moderate
regionalmoderate expression: see section 14 15 16
lung
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 16 17 18 19 20 21 22 23 24 moderate expression: see section 05 15
trachea
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 16
orbito-sphenoid
weak weak
regionalweak expression: see section 02 03 04 05 06 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50063
Entity Detected:Acsl5, acyl-CoA synthetase long-chain family member 5 ( MGI:1919129)
Sequence:sense strand is shown

>T50063
TGACACGCTGGGTACAGAAGCCATCATCTTTGTCATCAACAGGGCTGATATCCCTGTGGTCATCTGTGAT
ACACCCCAAAAGGCAACAATGCTAGTAGAAAATGTGGAAAAGGGCCTCACACCAGGCCTGAAGACGATCA
TCCTCATGGACCCTTTTGATGACGACCTGATGAAAAGAGGAGAAAAGTGTGGAGTTGAGATGTTATCCCT
GCATGATGCGGAGAATATAGGCAAAGAGAACTTCAAAAAACCAGTGCCTCCGAAGCCAGAGGATCTGAGC
GTCATCTGTTTCACCAGTGGAACTACAGGTGACCCCAAAGGAGCTATGCTAACCCATGAAAATGTTGTTT
CAAACATGGCTGCTTTCCTCAAATTTCTGGAGCCTATCTTCCAGCCCACCTCTGATGATGTGACCATATC
CTACCTTCCCTTGGCTCATATGTTTGAGAGGCTTGTCCAGGGTATCTTATTTTCCTGTGGAGGCAAAATT
GGGTTCTTCCAAGGAGATATCCGGTTGCTACCTGATGACATGAAGGCTTTGAAACCCACAGTGTTTCCTA
CAGTGCCTCGACTCCTTAACAGGGTCTATGATAAGGTACAAAATGAAGCCAAGACACCTTTGAAGAAGTT
CTTGTTGAACTTGGCTATCATCAGTAAATTCAATGAAGTGAAAAATGGCATCATTCGGCGGGACAGTTTG
TGGGACAAGCTCGTGTTTTCAAAGATTCAAGGAAGCCTGGGGGGGAAGGTTCGCCTCATGATCACTGGAG
CCGCCCCCATCTCCACTCCAGTCTTGACATTCTTCAGGGCTGCAATGGGATGTTGGGTGTTTGAAGCTTA
TGGCCAAACAGAATGCACAGGTGGATGTTCAATTACATCACCTGGGGACTGGACAGCAGGTCATGTTGGG
ACTCCAGT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:TGACACGCTGGGTACAGAAG; Reverse Primer - name:unspecified, sequence:ACTGGAGTCCCAACATGACC. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10232 same embryo
 EMAGE:10233 same embryo
 EurExpress:euxassay_018902 same experiment
 MGI:4822944 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS