Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10245

Ndufs1 NADH dehydrogenase (ubiquinone) Fe-S protein 1 ( MGI:2443241)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10245 EMAGE:10245 EMAGE:10245 EMAGE:10245 EMAGE:10245
"Pseudo-wholemount" of euxassay_018914. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018914_01 euxassay_018914_02 euxassay_018914_03 euxassay_018914_04
EMAGE:10245 EMAGE:10245 EMAGE:10245 EMAGE:10245 EMAGE:10245
euxassay_018914_05 euxassay_018914_06 euxassay_018914_07 euxassay_018914_08 euxassay_018914_09
EMAGE:10245 EMAGE:10245 EMAGE:10245 EMAGE:10245 EMAGE:10245
euxassay_018914_10 euxassay_018914_11 euxassay_018914_12 euxassay_018914_13 euxassay_018914_14
EMAGE:10245 EMAGE:10245 EMAGE:10245 EMAGE:10245 EMAGE:10245
euxassay_018914_15 euxassay_018914_16 euxassay_018914_17 euxassay_018914_18 euxassay_018914_19
EMAGE:10245 EMAGE:10245 EMAGE:10245 EMAGE:10245 EMAGE:10245
euxassay_018914_20 euxassay_018914_21 euxassay_018914_22 euxassay_018914_23 euxassay_018914_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10245Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10245_wholemount_strong.wlz
10245_wholemount_moderate.wlz
10245_wholemount_weak.wlz
10245_wholemount_possible.wlz
10245_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10245_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 19 20 21 22 23 24
thymus primordium
weak weak
regionalweak expression: see section 13 14 15 16 17
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 19 20 21 weak expression: see section 08 09 10 11 18
pancreas
weak weak
regionalweak expression: see section 11 12 13 14 18
vibrissa
weak weak
regionalweak expression: see section 05 06 07 08 19 20 21 22
olfactory cortex mantle layer
weak weak
regionalweak expression: see section 09 10 11 12 14 15 16 17
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 09 10 17 18
pons mantle layer
weak weak
regionalweak expression: see section 07 18
facial vii ganglion
weak weak
regionalweak expression: see section 05 06 21 22
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 08 09 19 20
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 18 19 20 21 22 23
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 07 19
ventral grey horn
weak weak
regionalweak expression: see section 12 13 14 15 16 17 18 19
dorsal root ganglion
weak weak
regionalweak expression: see section 09 10 11 12 13 14 18 19 20
neural retina
weak weak
regionalweak expression: see section 01 02 24
stomach
weak weak
regionalweak expression: see section 09 10 11
hindgut
weak weak
regionalweak expression: see section 15 16
midgut
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16 17 18 19 20
mandible
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 16 17 18 19 20 21 22 23 24
lower jaw incisor
weak weak
regionalweak expression: see section 12 13 16 17
lower jaw molar
weak weak
regionalweak expression: see section 07 19 20
maxilla
weak weak
regionalweak expression: see section 05 06 07 08 09 18 19 20 21
upper jaw incisor
weak weak
regionalweak expression: see section 11 12 13 16 17
upper jaw molar
weak weak
regionalweak expression: see section 07 19 20
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 17 18 19 20 21 weak expression: see section 11 12 13 14 15 16 22 23 24
testis
weak weak
regionalweak expression: see section 07 08 09 10 22 23 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 04 05 21 22 23 weak expression: see section 02 03 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50709
Entity Detected:Ndufs1, NADH dehydrogenase (ubiquinone) Fe-S protein 1 ( MGI:2443241)
Sequence:sense strand is shown

>T50709
AGATGCACTCTCTCGTGTAGCTGGAATGTTACAGAATTTTGAAGGCAATGCTGTGGCAGCGATTGCAGGA
GGCTTGGTGGATGCTGAAGCCTTAGTAGCTCTGAAAGACTTGCTTAATAAAGTTGACTCTGACAACTTAT
GCACTGAAGAGATCTTCCCCACTGAAGGAGCTGGTACAGACTTACGTTCCAATTATCTTCTCAATACCAC
AATTGCTGGTGTGGAAGAAGCAGATGTTGTTCTTCTAGTTGGTACAAATCCACGTTTTGAGGCACCGCTG
TTTAATGCTAGAATTAGAAAGAGCTGGCTTCATAATGACCTAAAAGTGGCCCTCATCGGTAGTCCAGTGG
ACCTCACTTACAGATACGACCATCTAGGAGACTCTCCTAAAATTCTGCAAGACATTGCTTCAGGGAGGCA
TTCATTCTGCGAGGTCTTAAAGGATGCTAAAAAACCAATGGTGGTTTTAGGCAGTTCTGCACTCCAGAGA
GATGATGGAGCAGCAATTCTTGCAGCTGTGTCCAACATGGTACAAAAGATTCGAGTGACAACCGGTGTTG
CTGCAGAGTGGAAAGTTATGAATATTCTGCATAGGATTGCAAGCCAGGTAGCTGCTTTGGACCTTGGCTA
TAAACCTGGGGTAGAAGCGATTAGGAAGAACCCTCCCAAAATGCTGTTTCTTCTGGGAGCAGATGGAGGT
TGTATCACGCGACAGGACTTGCCAAAGGATTGTTTCATTGTTTATCAAGGACACCATGGTGATGTTGGTG
CTCCCATGGCTGATGTTATTCTCCCAGGGGCTGCTTACACAGAAAAGTCTGCTACTTATGTCAATACTGA
GGGCAGAGCTCAGCAAACCAAAGTAGCAGTGACGCCT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:AGATGCACTCTCTCGTGTAG; Reverse Primer - name:unspecified, sequence:AGGCGTCACTGCTACTTTGG. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10244 same embryo
 EurExpress:euxassay_018914 same experiment
 MGI:4826646 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS