Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10254

Txnrd1 thioredoxin reductase 1 ( MGI:1354175)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10254 EMAGE:10254 EMAGE:10254 EMAGE:10254 EMAGE:10254
"Pseudo-wholemount" of euxassay_018922. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018922_01 euxassay_018922_02 euxassay_018922_03 euxassay_018922_04
EMAGE:10254 EMAGE:10254 EMAGE:10254 EMAGE:10254 EMAGE:10254
euxassay_018922_05 euxassay_018922_06 euxassay_018922_07 euxassay_018922_08 euxassay_018922_09
EMAGE:10254 EMAGE:10254 EMAGE:10254 EMAGE:10254 EMAGE:10254
euxassay_018922_10 euxassay_018922_11 euxassay_018922_12 euxassay_018922_13 euxassay_018922_14
EMAGE:10254 EMAGE:10254 EMAGE:10254 EMAGE:10254 EMAGE:10254
euxassay_018922_15 euxassay_018922_16 euxassay_018922_17 euxassay_018922_18 euxassay_018922_19
EMAGE:10254 EMAGE:10254 EMAGE:10254 EMAGE:10254
euxassay_018922_20 euxassay_018922_21 euxassay_018922_22 euxassay_018922_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10254Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10254_wholemount_strong.wlz
10254_wholemount_moderate.wlz
10254_wholemount_weak.wlz
10254_wholemount_possible.wlz
10254_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10254_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 03 22 23
axial musculature
weak weak
regionalweak expression: see section 04 05 06 07 19 20 21
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 16 17 18 19 20
pancreas
weak weak
regionalweak expression: see section 08 09 10 11 12 14 15 16
thyroid gland
weak weak
regionalweak expression: see section 11 15
vibrissa
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 19 20 21
cerebral cortex mantle layer
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22
telencephalon ventricular layer
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 16 17 18 19
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 09 15 16
pons mantle layer
weak weak
regionalweak expression: see section 06 17
midbrain ventricular layer
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15
ventral grey horn
weak weak
regionalweak expression: see section 10 11 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 07 08 09 10 15 16
pharyngo-tympanic tube
weak weak
regionalweak expression: see section 01 02 03 04 22 23
neural retina
weak weak
regionalweak expression: see section 01 02 22 23
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 07 08 09 10 11 12 14 15 16 17 19
mandible
weak weak
regionalweak expression: see section 02 03 04 05 07 08 09 18 19 20 21 22
lower jaw incisor
weak weak
regionalweak expression: see section 11 12 15 16
lower jaw molar
weak weak
regionalweak expression: see section 07 19
maxilla
weak weak
regionalweak expression: see section 07 08 09 17 18 19 20
upper jaw incisor
weak weak
regionalweak expression: see section 11 12 15 16
upper jaw molar
weak weak
regionalweak expression: see section 07 19
liver
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
clavicle
weak weak
regionalweak expression: see section 09 10 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T51116
Entity Detected:Txnrd1, thioredoxin reductase 1 ( MGI:1354175)
Sequence:sense strand is shown

>T51116
TTGTCAGTGACGAAGCGCTCTGGGGGAGACATCCTCCAGTCTGGCTGCTGAGGTTAAGCCCCAGTGTGGA
TGCTGTTGCCAAGACTACAGACCATTGCCTTGCTTCCTTGCCCACGCCCAGGTGAAGTTCAGGAAGGCTC
TTGGGTCCTAGGCGCCAATTCAAGGTGCTGTCCTAAGGCCACCGGGTCCCTGGGATCTTGTGGGTAGGAG
GTGGCAGGTCGAAGGAGGCTGCAGCATCGCACTGGGGTCACCATGACAGACTCAGACTGACATCTGGCAG
AGCATCACAGGCATGCGTCCATGAAGTCACTGGCCTCAAGCCCAAGTGGTGGGCAGTGACAGAAGAGCTG
CCGGGTCTGTTGAGCTCAACCTTTTCCTGTAGATTGTCTTAGTCTCACTTTCAAGCTGTCTAATGTCAAT
TCTGTTTTTTCTTTTTTCCTCCATGGGGTTAATGATACTAGAGATAGGGAATATTAGCAATCAGTTTTTG
TCATGGCTGGTCCATCTGCAACAGTCTTTACTGTGTGGAAGTGGGTGAGATGGCTTATGAGAGCCAAACC
AATTTATCCCCAGAAAGACGAATTACCCTGTGACTAAAATACACTGTCTGCTTTTACTAACTGGTGTAGC
ATTGTCTCCTTTAATAAGTCTTGTGTCCAAAACGAGAAAAACCATTGGCCACTTTTGCAAGTTTCCTGCA
GTGTGCTTAGCAAGGGAGGTGGCGACTTGGCTAATCTACTTGAACTGCATCGCATGGCTCTTGGGTAGCT
TAGAGCATCGCAGGGTAGAGGCAGACCAGCAGTGAGTGTCTCTCCTGGTACAATTATTGTCTGGTTCTCA
GTGGAAAACGCTTAATTTGCTTTAAACTTGGTGTTTTTGTGAGGTGGATTTAGTCTTA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:TTGTCAGTGACGAAGCGCTC; Reverse Primer - name:unspecified, sequence:TAAGACTAAATCCACCTCAC. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10253 same embryo
 EMAGE:10256 same embryo
 EMAGE:10255 same embryo
 EurExpress:euxassay_018922 same experiment
 MGI:4829035 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS