Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10257

Jam3 junction adhesion molecule 3 ( MGI:1933825)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10257 EMAGE:10257 EMAGE:10257 EMAGE:10257 EMAGE:10257
"Pseudo-wholemount" of euxassay_000180. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000180_01 euxassay_000180_02 euxassay_000180_03 euxassay_000180_04
EMAGE:10257 EMAGE:10257 EMAGE:10257 EMAGE:10257 EMAGE:10257
euxassay_000180_05 euxassay_000180_06 euxassay_000180_07 euxassay_000180_08 euxassay_000180_09
EMAGE:10257 EMAGE:10257 EMAGE:10257 EMAGE:10257 EMAGE:10257
euxassay_000180_10 euxassay_000180_11 euxassay_000180_12 euxassay_000180_13 euxassay_000180_14
EMAGE:10257 EMAGE:10257 EMAGE:10257 EMAGE:10257 EMAGE:10257
euxassay_000180_15 euxassay_000180_16 euxassay_000180_17 euxassay_000180_18 euxassay_000180_19
EMAGE:10257 EMAGE:10257 EMAGE:10257 EMAGE:10257 EMAGE:10257
euxassay_000180_20 euxassay_000180_21 euxassay_000180_22 euxassay_000180_23 euxassay_000180_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10257Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10257_wholemount_strong.wlz
10257_wholemount_moderate.wlz
10257_wholemount_weak.wlz
10257_wholemount_possible.wlz
10257_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10257_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diaphragm
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 20 21 22 23 24 weak expression: see section 10 11 12 19
limb
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 22 23 24
head mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22 23 24
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 weak expression: see section 15
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 13
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14
cerebral cortex
strong strong
homogeneousstrong expression: see section 19
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 11 16 17 18
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 13 weak expression: see section 11 14 15 16 17
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 16 17
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 12 13 weak expression: see section 11 14 15 16 17
metencephalon rest of alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 18 19 20 21 22 weak expression: see section 14 16 17
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13
midbrain mantle layer
weak weak
regionalweak expression: see section 08 09 17 18
midbrain ventricular layer
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 13 14 15
tongue
moderate moderate
regionalmoderate expression: see section 14 15 weak expression: see section 12 13 24
chondrocranium
weak weak
regionalweak expression: see section 01 02 03 04 05 06 21 22 23 24
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2293
Entity Detected:Jam3, junction adhesion molecule 3 ( MGI:1933825)
Sequence:sense strand is shown

>T2293
GGCCTCNAGGCCAGATTCGGATCCTTGCCTGACCTCATTATGGGGATTAGGGTGATCTTCAAGGCCTTTC
TGGTCTCCGTTCTCCCATGCAGGGCAATTTGGACTGTTTTTGCCCCAGGCTGTTTAGCTGCCAGGACAAC
ACTGGCAGAGAGAGGCTGAGGCGCTGGGCTGCAGTAGCAGCAGGCAACAGCCTGATGCCTGTGACAGTGC
CCCAGGAAGGTTTTCAGGCAGTGCCTTGCTCCCTGGACCCTGACCCACCGTGTTGCCTCTGTTGATTGGC
CAGTACTGTCATTTCCATCCTGGAGAATGTGTTTGGAATCAGCATTTTATAAAAAACCCAAATCAGAAAG
GTGAAATTGCTTGCTGGGAAGAGGGCTCTGACCCAGGAAACTCTCCTTCCCAAGAGATGCCAGGAGATAG
GAGAACCTGTCTGTCTTAAGTCTGAAATGGTACTGAAGTCTCCTTTTCTATTGGTCTTGCTTATTTTATA
AAAATTTAACATTCTAAATTTTGCTAGAGATGTATTTTGATTACTGAAAATTTCTATATAAACTGTAAAT
AT
Notes:The probe template was PCR amplified from IMAGE:1121556 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1121556 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10258 same embryo
 EurExpress:euxassay_000180 same experiment
 MGI:4825677 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS