Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10259

Dpyd dihydropyrimidine dehydrogenase ( MGI:2139667)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10259 EMAGE:10259 EMAGE:10259 EMAGE:10259 EMAGE:10259
"Pseudo-wholemount" of euxassay_000078. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000078_01 euxassay_000078_02 euxassay_000078_03 euxassay_000078_04
EMAGE:10259 EMAGE:10259 EMAGE:10259 EMAGE:10259 EMAGE:10259
euxassay_000078_05 euxassay_000078_06 euxassay_000078_07 euxassay_000078_08 euxassay_000078_09
EMAGE:10259 EMAGE:10259 EMAGE:10259 EMAGE:10259 EMAGE:10259
euxassay_000078_10 euxassay_000078_11 euxassay_000078_12 euxassay_000078_13 euxassay_000078_14
EMAGE:10259 EMAGE:10259 EMAGE:10259 EMAGE:10259 EMAGE:10259
euxassay_000078_15 euxassay_000078_16 euxassay_000078_17 euxassay_000078_18 euxassay_000078_19
EMAGE:10259 EMAGE:10259 EMAGE:10259 EMAGE:10259 EMAGE:10259
euxassay_000078_20 euxassay_000078_21 euxassay_000078_22 euxassay_000078_23 euxassay_000078_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10259Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10259_wholemount_strong.wlz
10259_wholemount_moderate.wlz
10259_wholemount_weak.wlz
10259_wholemount_possible.wlz
10259_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10259_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 13 18
cranial musculature
moderate moderate
regionalmoderate expression: see section 04 05 06 07 09 10 18 21 weak expression: see section 19
cranial muscle
strong strong
regionalstrong expression: see section 05 moderate expression: see section 06 09 10 11
masseter
moderate moderate
regionalmoderate expression: see section 02 03
pectoral girdle and thoracic body wall musculature
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 09 10 11 13 18 21 24 weak expression: see section 19
pectoral girdle and thoracic body wall muscle
strong strong
regionalstrong expression: see section 05 moderate expression: see section 06 07 09 11
pelvic girdle musculature
moderate moderate
regionalmoderate expression: see section 03 04 05 07 08 09 23 24
pelvic girdle muscle
strong strong
regionalstrong expression: see section 05 moderate expression: see section 04 06 08 09
thymus primordium
weak weak
homogeneousweak expression: see section 18
salivary gland
moderate moderate
regionalmoderate expression: see section 21
sublingual gland primordium
moderate moderate
regionalmoderate expression: see section 21
gut
moderate moderate
regionalmoderate expression: see section 17
thyroid gland
weak weak
homogeneousweak expression: see section 11
neurohypophysis
strong strong
regionalstrong expression: see section 13 14 16 17
vibrissa
moderate moderate
regionalmoderate expression: see section 22 23 weak expression: see section 05
hypothalamus
strong strong
regionalstrong expression: see section 14 moderate expression: see section 15
diencephalon lamina terminalis
strong strong
regionalstrong expression: see section 16
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 13
thalamus
strong strong
regionalstrong expression: see section 14
thalamus marginal layer
strong strong
regionalstrong expression: see section 13
cerebral cortex
strong strong
regionalstrong expression: see section 15 16
cerebral cortex ventricular layer
strong strong
regionalstrong expression: see section 04 05 06 08 09 10 11 12 15 16 17 18 19 20 21 22 23 24 moderate expression: see section 01 02 03 07
metencephalon
strong strong
regionalstrong expression: see section 15
metencephalon alar plate
strong strong
regionalstrong expression: see section 14
cerebellum
strong strong
regionalstrong expression: see section 04 11 12 14 15 17 19 moderate expression: see section 23 weak expression: see section 16
rest of cerebellum
strong strong
regionalstrong expression: see section 11 12 17 18 20
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 12 15 20
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 24 moderate expression: see section 23
metencephalon rest of alar plate ventricular layer
strong strong
spottedstrong expression: see section 04 05
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 12 14 19 20
midbrain
strong strong
regionalstrong expression: see section 16 17 18
midbrain lateral wall
strong strong
regionalstrong expression: see section 13 14 15 16 17 18
midbrain ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18 19
vagus x ganglion
strong strong
regionalstrong expression: see section 15
dorsal root ganglion
strong strong
regionalstrong expression: see section 21 22 moderate expression: see section 23
inner ear
strong strong
regionalstrong expression: see section 05
labyrinth
moderate moderate
regionalmoderate expression: see section 03 21
labyrinth epithelium
moderate moderate
regionalmoderate expression: see section 20
otic capsule
moderate moderate
regionalmoderate expression: see section 02 04 07 09 11 20 weak expression: see section 19 23
inner ear vestibular component
strong strong
regionalstrong expression: see section 05 moderate expression: see section 06 07
ossicle
moderate moderate
regionalmoderate expression: see section 03
tubotympanic recess
moderate moderate
gradedmoderate expression: see section 02
retina
moderate moderate
regionalmoderate expression: see section 01 02
nasal meatus
weak weak
regionalweak expression: see section 18
nasal cavity
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 23
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 06 11
nasal septum epithelium
weak weak
regionalweak expression: see section 15
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
vomeronasal organ
weak weak
regionalweak expression: see section 13
internal anal sphincter
strong strong
regionalstrong expression: see section 15
esophagus
strong strong
regionalstrong expression: see section 15
lower jaw
moderate moderate
regionalmoderate expression: see section 23 weak expression: see section 19 20
oral epithelium
weak weak
regionalweak expression: see section 14
meckel's cartilage
strong strong
regionalstrong expression: see section 16 moderate expression: see section 13
lower jaw mesenchyme
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 19
lower jaw alveolar sulcus
strong strong
regionalstrong expression: see section 16
lower jaw incisor
strong strong
regionalstrong expression: see section 16 moderate expression: see section 13 21 weak expression: see section 19
metanephros
weak weak
homogeneousweak expression: see section 12 20
urorectal septum
strong strong
regionalstrong expression: see section 15
lung
strong strong
spottedstrong expression: see section 06 07 08 09 10 11 12 13 14 16 17 18 20 21 22 23 weak expression: see section 05
nucleus pulposus
weak weak
homogeneousweak expression: see section 16
esophagus lumen
strong strong
regionalstrong expression: see section 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2266
Entity Detected:Dpyd, dihydropyrimidine dehydrogenase ( MGI:2139667)
Sequence:sense strand is shown

>T2266
GGCCTCGAGCCAGATTCGGCACGAGGGTAACTGCAGACCAGTTAATTGGATGTGCTCTGTCCGTTGTGTG
CTGTGAAAAATTAACTTTTTCATGGCAATTAGCGTGACAATTTCTAAATTGCCCTATGCCGTACTCACTC
TTTGATTTCTAATTGTAAACGAAATGAACTATTTTGGAACGGAGTGCACTTTCATATACAGGAAACCGTT
TCCAAGGAAACGCTTTGTAATTAAAAATTACCTGTAATTTTAACACTGTTTCTAAGGACATGTAATTAGT
TCCATTAAGAACAATTGAAGAAAGTCAAGGCATTATTTACTATGACAAGGGGGAAGAAAACCTGGAAGAG
GGTTTCTAGAGTTTTCTAAAGTCCCCCTTTGCTGAAGTAACTCACTCTTCGGTGCTGGACACGGAAAGGG
AGATTATTTCCTGACTAAAATGCTGTTGACCACCTGAAACAGGTGTCAGACTGACCAGGGATGGAGTCCT
GGCCATTTTTATTTGAATACCAAAGCGGTGTTCCTAATGAAATAAGATATCGAGGTGAATGTCTGGTG
Notes:The probe template was PCR amplified from IMAGE:1068530 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1068530 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4824390 same experiment
 EurExpress:euxassay_000078 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS