Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10265

Gsta4 glutathione S-transferase, alpha 4 ( MGI:1309515)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10265 EMAGE:10265 EMAGE:10265 EMAGE:10265 EMAGE:10265
"Pseudo-wholemount" of euxassay_018933. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018933_01 euxassay_018933_02 euxassay_018933_03 euxassay_018933_04
EMAGE:10265 EMAGE:10265 EMAGE:10265 EMAGE:10265 EMAGE:10265
euxassay_018933_05 euxassay_018933_06 euxassay_018933_07 euxassay_018933_08 euxassay_018933_09
EMAGE:10265 EMAGE:10265 EMAGE:10265 EMAGE:10265 EMAGE:10265
euxassay_018933_10 euxassay_018933_11 euxassay_018933_12 euxassay_018933_13 euxassay_018933_14
EMAGE:10265 EMAGE:10265 EMAGE:10265 EMAGE:10265 EMAGE:10265
euxassay_018933_15 euxassay_018933_16 euxassay_018933_17 euxassay_018933_18 euxassay_018933_19
EMAGE:10265 EMAGE:10265 EMAGE:10265 EMAGE:10265
euxassay_018933_20 euxassay_018933_21 euxassay_018933_22 euxassay_018933_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10265Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10265_wholemount_strong.wlz
10265_wholemount_moderate.wlz
10265_wholemount_weak.wlz
10265_wholemount_possible.wlz
10265_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10265_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 11 12 13
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 16 17 18
pituitary gland
weak weak
regionalweak expression: see section 09 10 11 12 13 14
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 weak expression: see section 10
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 15 16 17 18 moderate expression: see section 12 13 14
olfactory cortex ventricular layer
weak weak
regionalweak expression: see section 11 12 13 16 17 18
telencephalon ventricular layer
weak weak
regionalweak expression: see section 02 03 04 05 09 10 11 12 13 14 15 16 17 18 19 20 21 22
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 01 02 03 04 07 08 09 10 11 15 16 17 19 moderate expression: see section 05 06 12 13 14
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 weak expression: see section 08 09 10
intermediate grey horn
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15
cochlea
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 15 16 17
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19 weak expression: see section 20
heart ventricle
strong strong
regionalstrong expression: see section 09 10 11 12 weak expression: see section 13
esophagus
strong strong
regionalstrong expression: see section 11 weak expression: see section 12
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12
bladder
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 15
metanephros
weak weak
regionalweak expression: see section 07 08 09 10 16 17 18 19 20
ovary
moderate moderate
regionalmoderate expression: see section 05 06 07 08 19 20 21 weak expression: see section 22
paramesonephric duct of female, rest of
weak weak
regionalweak expression: see section 15
larynx
weak weak
regionalweak expression: see section 11 12
lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 13 14 15 16 17 18 19 weak expression: see section 11 12 20 21 22 23
trachea
weak weak
regionalweak expression: see section 11 12
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 15 16 17 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50464
Entity Detected:Gsta4, glutathione S-transferase, alpha 4 ( MGI:1309515)
Sequence:sense strand is shown

>T50464
TTTCTCGAGTGCCTGGAGACAAAAATCCCACAAGAATAAGGAAGCTCTGAAGCAGGAGTCATGGCAGCCA
AACCTAAGCTCTACTACTTTAATGGCAGGGGACGGATGGAGTCGATCCGCTGGCTGCTGGCTGCGGCTGG
AGTGGAGTTTGAGGAAGAATTTCTTGAGACAAGGGAACAGTATGAGAAGATGCAAAAGGATGGACACCTG
CTTTTCGGCCAAGTACCCTTGGTTGAAATCGATGGGATGATGCTGACACAGACCAGGGCCATCCTCAGCT
ACCTCGCTGCCAAGTACAACTTGTATGGGAAGGACCTGAAGGAGAGAGTCAGGATTGACATGTATGCAGA
TGGCACCCAGGACCTGATGATGATGATTGCCGTGGCTCCATTTAAAACCCCCAAGGAAAAAGAGGAGAGC
TATGATTTGATACTGTCAAGAGCTAAAACCCGTTACTTCCCAGTGTTTGAAAAGATTTTAAAAGACCACG
GAGAGGCTTTTCTCGTTGGCAACCAGCTCAGTTGGGCAGACATCCAGCTCCTAGAAGCCATTTTGATGGT
GGAAGAACTCAGTGCCCCTGTACTGTCCGACTTCCCTCTGCTGCAGGCATTTAAGACAAGAATCAGCAAC
ATTCCTACAATTAAGAAGTTCCTGCAACCCGGAAGTCAGAGGAAGCCTCCTCCAGATGGCCCCTATGTTG
AGGTGGTCAGGATTGTCCTGAAGTTCTAGTGCAGCGTGCTTTAAGGTGGCACCCACAAGGTTCCAATTGC
AGTGTCACCACAGGCCAGCTGCAGAGCATTCCAGAAGCAAGGTATATAGATCCCAGGAGTCAAGCTCTTC
AAACAACAAAACCACTCTGCCCACAATGACA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:TTTCTCGAGTGCCTGGAGAC; Reverse Primer - name:unspecified, sequence:TGTCATTGTGGGCAGAGTGG. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10267 same embryo
 EMAGE:10266 same embryo
 EurExpress:euxassay_018933 same experiment
 MGI:4825259 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS