Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10330

Acaca acetyl-Coenzyme A carboxylase alpha ( MGI:108451)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10330 EMAGE:10330 EMAGE:10330 EMAGE:10330 EMAGE:10330
"Pseudo-wholemount" of euxassay_018925. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018925_01 euxassay_018925_02 euxassay_018925_03 euxassay_018925_04
EMAGE:10330 EMAGE:10330 EMAGE:10330 EMAGE:10330 EMAGE:10330
euxassay_018925_05 euxassay_018925_06 euxassay_018925_07 euxassay_018925_08 euxassay_018925_09
EMAGE:10330 EMAGE:10330 EMAGE:10330 EMAGE:10330 EMAGE:10330
euxassay_018925_10 euxassay_018925_11 euxassay_018925_12 euxassay_018925_13 euxassay_018925_14
EMAGE:10330 EMAGE:10330 EMAGE:10330 EMAGE:10330 EMAGE:10330
euxassay_018925_15 euxassay_018925_16 euxassay_018925_17 euxassay_018925_18 euxassay_018925_19
EMAGE:10330 EMAGE:10330 EMAGE:10330 EMAGE:10330 EMAGE:10330
euxassay_018925_20 euxassay_018925_21 euxassay_018925_22 euxassay_018925_23 euxassay_018925_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10330Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10330_wholemount_strong.wlz
10330_wholemount_moderate.wlz
10330_wholemount_weak.wlz
10330_wholemount_possible.wlz
10330_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10330_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
axial musculature
weak weak
regionalweak expression: see section 07 08 09 10 22 23 24
thymus primordium
weak weak
regionalweak expression: see section 13 14 15 16 17 18
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 18 19 20 21
thyroid gland
weak weak
regionalweak expression: see section 13 17 18
vibrissa
weak weak
regionalweak expression: see section 06 07 08 09 20 21 22 23 24
cerebral cortex mantle layer
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12 13 16 17 18 19 20 21 22 23 24
olfactory cortex mantle layer
weak weak
regionalweak expression: see section 11 12 13 16 17 18 19
telencephalon ventricular layer
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 16 17 18 19 20 21 22 23 24
midbrain ventricular layer
weak weak
regionalweak expression: see section 11 12 13 14 15 16 17
facial vii ganglion
weak weak
regionalweak expression: see section 05 07 23
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 08 09 20 21
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 19 20 21 22 23 24
vagus x ganglion
weak weak
regionalweak expression: see section 10 11 19
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 12 19
cervical ganglion
weak weak
regionalweak expression: see section 11 19
thoracic ganglion
weak weak
regionalweak expression: see section 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 18 19 weak expression: see section 10 11 12 13 20
neural retina
weak weak
regionalweak expression: see section 01 02 03 04
esophagus
weak weak
regionalweak expression: see section 15
stomach
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10
midgut
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19
lower jaw incisor
weak weak
regionalweak expression: see section 12 13 16 17
upper jaw incisor
weak weak
regionalweak expression: see section 12 13 16 17
lung
moderate moderate
regionalmoderate expression: see section 10 11 20 weak expression: see section 06 07 08 09 12 13 14 15 16 17 18 19 21 22 23 24
clavicle
weak weak
regionalweak expression: see section 11 12 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50048
Entity Detected:Acaca, acetyl-Coenzyme A carboxylase alpha ( MGI:108451)
Sequence:sense strand is shown

>T50048
TTGTTTGGTCGTGACTGCTCTGTGCAGCGCAGGCATCAGAAGATCATTGAAGAAGCTCCTGCTGCGATTG
CTACCCCAGCAGTATTTGAACACATGGAACAGTGTGCAGTGAAACTTGCCAAAATGGTTGGTTATGTGAG
TGCTGGGACTGTGGAATACTTGTACAGCCAGGATGGAAGCTTCTACTTTTTGGAACTGAACCCTCGGCTA
CAGGTTGAACATCCTTGTACAGAGATGGTGGCTGATGTCAATCTTCCTGCAGCACAGCTCCAGATTGCCA
TGGGGATCCCTCTATTTAGGATCAAGGATATTCGTATGATGTATGGGGTATCTCCTTGGGGAGATGCTCC
CATTGATTTTGAAAATTCTGCTCATGTTCCTTGCCCAAGGGGCCACGTGATTGCTGCTCGGATCACCAGT
GAAAACCCAGATGAGGGGTTTAAGCCCAGCTCTGGAACAGTTCAGGAACTTAATTTTCGTAGCAATAAGA
ACGTTTGGGGTTATTTCAGTGTTGCTGCTGCTGGAGGACTTCATGAATTTGCTGATTCTCAGTTCGGGCA
CTGCTTTTCCTGGGGAGAAAACAGGGAGGAAGCAATCTCAAATATGGTGGTGGCACTGAAGGAGCTGTCT
ATTCGGGGTGACTTTCGAACTACAGTGGAATACCTCATCAAACTGCTGGAGACAGAAAGCTTTCAGCTTA
ACAGAATCGACACTGGCTGGCTGGACAGACTGATCGCAGAGAAAGTGCAGGCAGGGCGACCTGACACCAT
GTTGGGAGTTGTGTGTGGGGCTCTCCATGTAGCAGATGTGAGCCTGAGGAACAGCATCTCTAACTTCCTT
CACTCCTTAGAGAGGGGTCAAGTCCTTCCTGCTCACACACTTCTGAACACAGTAGATGTTGAACTTATCT
ATGAAGGAATCAAATATGTACTTAAGGTGACCCGGCA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:TTGTTTGGTCGTGACTGCTC; Reverse Primer - name:unspecified, sequence:TGCCGGGTCACCTTAAGTAC. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10332 same embryo
 EMAGE:10331 same embryo
 EurExpress:euxassay_018925 same experiment
 MGI:4822896 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS