Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10450

Krt8 keratin 8 ( MGI:96705)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10450 EMAGE:10450 EMAGE:10450 EMAGE:10450 EMAGE:10450
"Pseudo-wholemount" of euxassay_000582. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000582_01 euxassay_000582_02 euxassay_000582_03 euxassay_000582_04
EMAGE:10450 EMAGE:10450 EMAGE:10450 EMAGE:10450 EMAGE:10450
euxassay_000582_05 euxassay_000582_06 euxassay_000582_07 euxassay_000582_08 euxassay_000582_09
EMAGE:10450 EMAGE:10450 EMAGE:10450 EMAGE:10450 EMAGE:10450
euxassay_000582_10 euxassay_000582_11 euxassay_000582_12 euxassay_000582_13 euxassay_000582_14
EMAGE:10450 EMAGE:10450 EMAGE:10450 EMAGE:10450 EMAGE:10450
euxassay_000582_15 euxassay_000582_16 euxassay_000582_17 euxassay_000582_18 euxassay_000582_19
EMAGE:10450 EMAGE:10450 EMAGE:10450 EMAGE:10450 EMAGE:10450
euxassay_000582_20 euxassay_000582_21 euxassay_000582_22 euxassay_000582_23 euxassay_000582_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10450Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10450_wholemount_strong.wlz
10450_wholemount_moderate.wlz
10450_wholemount_weak.wlz
10450_wholemount_possible.wlz
10450_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10450_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
embryo
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
thymus primordium
strong strong
homogeneousstrong expression: see section 13 14 15 16 17
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 10 11 18 19 20 21
foregut-midgut junction
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19 20 21 22
pancreas
moderate moderate
regionalmoderate expression: see section 10 11 12 13
pituitary gland
weak weak
regionalweak expression: see section 12 13 14 15 16 17
vibrissa
weak weak
regionalweak expression: see section 05 06 07 08 24
lateral ventricle choroid plexus
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
4th ventricle
weak weak
regionalweak expression: see section 04 05 06 07 08 10 11 12 13 14 15 16 17 18 19 20 21
ear
strong strong
regionalstrong expression: see section 10
cochlea
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 18 19 20 21 24
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 10 moderate expression: see section 01 04 05 06 07 08 09 20 21 22 23 24 weak expression: see section 02 03
tubotympanic recess
moderate moderate
regionalmoderate expression: see section 03 05 06 07 08 09 10 19 20 21 23 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19 20 21
anal canal
strong strong
regionalstrong expression: see section 15 16
esophagus
strong strong
regionalstrong expression: see section 13 14 15
stomach
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12
hindgut
strong strong
regionalstrong expression: see section 15 16 17
midgut
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19 20 21
oral epithelium
moderate moderate
regionalmoderate expression: see section 07 08 10 11 12 13 14 15 16 17 18 19 20 weak expression: see section 09 21 22 23 24
liver lobe
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
bladder
moderate moderate
regionalmoderate expression: see section 15 16
kidney calyx
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 12 18 21 22
kidney pelvis
moderate moderate
regionalmoderate expression: see section 11 19 20
male reproductive system
strong strong
regionalstrong expression: see section 15 16
urethra of male
strong strong
regionalstrong expression: see section 15 16 weak expression: see section 17
laryngeal cartilage
strong strong
regionalstrong expression: see section 13 14 15
lung
moderate moderate
spottedmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T810
Entity Detected:Krt8, keratin 8 ( MGI:96705)
Sequence:sense strand is shown

>T810
TCTCGAGNCTGTTGGCCTACTGGACCGTCTAGAAGCAGCTGCTTAGCTCGCTCTCGAACCTCCGTCTTCA
GCTCACTGCCTTCGCTCCAGACTTCACCATGTCCATCAGGGTGACTCAGAAATCCTACAAGATGTCCACC
TCCGGTCCCCGGGCCTTCAGCAGCCGCTCGTTCACGAGTGGACCCGGTGCCCGCATCAGCTCTTCCAGCT
TTTCCCGGGTGGGCAGCAGCAGCAGCAGCTTCCGGGGAAGCATGGGCACCGGCGTGGGTCTGGGCGGCTT
TGGCGGGGCTGGTGTCGGGGGCATCACAGCCGTCACGGTGAACCAGAGCCTGTTGAGCCCCTTGAAGCTG
GAGGTGGACCCCAACATCCAGGCTGTGCGCACTCAGGAGAAGGAGCAGATTAAATCCCTGAACAACAAGT
TCGCCTCCTTCATTGACAAGGTGCGCTTCCTGGAGCAGCAGAACAAGATGCTGGAGACCAAGTGGAGCCT
GTTGCAGCAGCAGAAGACGTCGAGGAGCAACATGGACAACATGTTTGAGAGCTA
Notes:The probe template was PCR amplified from IMAGE:1921806 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1921806 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10448 same embryo
 EMAGE:10449 same embryo
 EMAGE:10451 same embryo
 EurExpress:euxassay_000582 same experiment
 MGI:4825848 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS