Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10576

Suclg2 succinate-Coenzyme A ligase, GDP-forming, beta subunit ( MGI:1306824)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10576 EMAGE:10576 EMAGE:10576 EMAGE:10576 EMAGE:10576
"Pseudo-wholemount" of euxassay_018982. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018982_01 euxassay_018982_02 euxassay_018982_03 euxassay_018982_04
EMAGE:10576 EMAGE:10576 EMAGE:10576 EMAGE:10576 EMAGE:10576
euxassay_018982_05 euxassay_018982_06 euxassay_018982_07 euxassay_018982_08 euxassay_018982_09
EMAGE:10576 EMAGE:10576 EMAGE:10576 EMAGE:10576 EMAGE:10576
euxassay_018982_10 euxassay_018982_11 euxassay_018982_12 euxassay_018982_13 euxassay_018982_14
EMAGE:10576 EMAGE:10576 EMAGE:10576 EMAGE:10576 EMAGE:10576
euxassay_018982_15 euxassay_018982_16 euxassay_018982_17 euxassay_018982_18 euxassay_018982_19
EMAGE:10576 EMAGE:10576
euxassay_018982_20 euxassay_018982_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10576Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10576_wholemount_strong.wlz
10576_wholemount_moderate.wlz
10576_wholemount_weak.wlz
10576_wholemount_possible.wlz
10576_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10576_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 15 16 17 18 19 20
thymus primordium
moderate moderate
regionalmoderate expression: see section 07 08 10 11 12 weak expression: see section 09
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 05 06 14 15 16 17
pancreas
moderate moderate
regionalmoderate expression: see section 06 07 08 09 13 14
thyroid gland
weak weak
regionalweak expression: see section 08 12 13
pituitary gland
weak weak
regionalweak expression: see section 09 11 12
vibrissa
weak weak
regionalweak expression: see section 04 05 06 20
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 09 10 11 12
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 20 21
olfactory cortex ventricular layer
weak weak
regionalweak expression: see section 09 10 11 14 15
telencephalon ventricular layer
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 12 13 14 15 16 17 18 19
midbrain ventricular layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14
spinal cord ventricular layer
weak weak
regionalweak expression: see section 08
pharyngo-tympanic tube
weak weak
regionalweak expression: see section 01 02 20 21
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 06 07 12 14 15 16 17 18
stomach
moderate moderate
regionalmoderate expression: see section 06 07 weak expression: see section 04 05
hindgut
moderate moderate
regionalmoderate expression: see section 12 13 14
midgut
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
mandible
weak weak
regionalweak expression: see section 03 04 06 07 16 17 19 20
lower jaw incisor
weak weak
regionalweak expression: see section 09 10 13 14 15
lower jaw molar
weak weak
regionalweak expression: see section 05
maxilla
weak weak
regionalweak expression: see section 06 07 16 17
upper jaw incisor
weak weak
regionalweak expression: see section 09 10 14 15
upper jaw molar
weak weak
regionalweak expression: see section 05
liver
moderate moderate
regionalmoderate expression: see section 01 02 06 weak expression: see section 03 04 05 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
metanephros
weak weak
regionalweak expression: see section 05 06 07 08 14 15 16 17 18 19
urethra of male
weak weak
regionalweak expression: see section 12 13
lung
weak weak
regionalweak expression: see section 04 05 06 07 08 10 11 12 13 14 15 16 17
orbito-sphenoid
weak weak
regionalweak expression: see section 01 02 03 04 05 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T51071
Entity Detected:Suclg2, succinate-Coenzyme A ligase, GDP-forming, beta subunit ( MGI:1306824)
Sequence:sense strand is shown

>T51071
TACCTGCGACATCATCTTCCTGAACGGAGGGAAGCCAGCGAACTTCTTGGACCTTGGAGGTGGTGTAAAG
GAAGCCCAAGTCTATGAAGCATTCAAACTGCTCACGTCTGACCCCAAGGTGGAAGCCATTCTCGTCAATA
TCTTTGGTGGGATCGTCAACTGTGCCATCATTGCCAACGGAATCACCAAAGCCTGCCGGGAGCTGGAGCT
CAAGGTGCCACTGGTAGTCCGGCTTGAAGGAACTAATGTGCAGGAGGCTCAGAATATCCTCAAGAGCAGC
GGACTCCCCATCACGTCAGCTGTGGACCTGGAGGATGCAGCCAAGAAAGCTGTTGCCAGTGTGGCAAAGA
AGTGATGCTCTCCCTGGCTCCCATGAAGAAGGGCATGTCCCTGACTACTGTGAAAGCAATTGTTTTCTCA
CTGGGAAGGGACACACACAAGGATCATCATGTGAAAAATATTAACTCTGAACTTTCTCAAATACGTTATC
CAGAGTGCCTAAAGCTGAATTTATACTGTAGTCATTGTTAAAAAAAAAAATCACTCCTTACAATTTCACA
TCTTCTCTTGCCCATTCAGTAGCAGGGTCTACCAGCTCTGGGCCACAGTCAGTTTAGCCAAATAGTGTGC
ATACATACAGTATTTAAAGCCAGATCTAGGTTCATTCACAAGGGCATTTATTCTACATTAGAAAATTTTA
CAGGACCCTCAAGTTCAGACAGGCTGATATTTAACATAGTGGCTTCCAGAAGGGTACAGCTAAGACACCT
GAGCTTCTGTGACCAGTGGCCTCCACTGGCCCCTAATTCCAGTACATTAAGAAAGCCCATGAACATTTCT
AAAGTGTGGCTTATATTGGGCATCCCGTGTTGATATATGTACATTGCACACATTTTACCCTGTGCCTTAA
TGTTGAATCTACTGTTTGCCTCACACTAAGTTACTACCAGAAGCCTTAGTCAT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:TACCTGCGACATCATCTTCC; Reverse Primer - name:unspecified, sequence:ATGACTAAGGCTTCTGGTAG. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10578 same embryo
 EMAGE:10580 same embryo
 EMAGE:10579 same embryo
 EMAGE:10577 same embryo
 EurExpress:euxassay_018982 same experiment
 MGI:4828535 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS